설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCCAAAGAGGAGATCAATGTACTTCATGGTCGCCTGGAGAAGCTGAATCTTGTAAATATGAACAACATAGAAAATTATGTTGACAGCAAAGTGGCAAATCTAACATTTGTTGTCAATAGTTTGGATGGCAAATGTTCAAAGTGTCCCAGCCAAGAACAAATACAGTCACGTCCAGTTCAACATCTAATATATAAAGATTGCTCTGACTACTACGCAATAGGCAAAAGAAGCAGTGAGACCTACAGAGTTACACCTGATCCCAAAAATAGTAGCTTTGAAGTTTACTGTGACATGGAGACCATGGGGGGAGGCTGGACAGTGCTGCAGGCACGTCTCGATGGGAGCACCAACTTCACCAGAACATGGCAAGACTACAAAGCAGGCTTTGGAAACCTCAGAAGGGAATTTTGGCTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FGL2(10875) , FGL2(10875)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ming Tang et al.
Scientific reports, 7(1), 12676-12676 (2017-10-06)
Fibrinogen-like protein 2 (FGL2) is highly expressed in various tumour tissues and plays a vital role in tumour initiation and progression. This study evaluated the clinical significance of FGL2 in patients with clear cell renal cell carcinoma (ccRCC). FGL2 expression
Yueying Wang et al.
Molecular reproduction and development, 86(4), 354-369 (2019-01-12)
Embryonic implantation involves a complex and well-coordinated interaction between the developing conceptus and maternal uterus, and the preimplantation period has a major impact on litter size in pigs. The present study aimed to investigate the vital messenger RNAs (mRNAs) and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.