추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CCAAGATGCCAGTTTTTGCTTCTTTGTTAGTTGTCAGCTGCTTTTATCAAATTTCAGGCCATTATCCAACAAACACTATAAAAATGTTTGAACAATTGGATTTCAAACATTTTCGTTTTGTGGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGCAAGTGAACACAAACACATTTAAGTGTATTTTGTCTGATTAGATGTTAGCCAGTTATGCTATTTCATTCAAATGTCTGAAAAAATCAATTGACTATTCCCTTTTCCTAAAGGGCAGAGACAGATAATCTCACTTCCAGAGAAATGACTTGGAGAAAAAAAAGTGTTGGTCTTTTTGCTCTTTTGTAATTAAATCCGGATGTACCTCAAAAGACTTAAGACTGTGGTGATAAGATGCTTTCCTCAGCAGAAAGGAGGGAAAAAAAACAACTGGAACTCAAAGCTTGAAATTCTGTGGCAAAACATGAGATGTCCAGGATTGGAGGTTGAA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TUG1(55000)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Kewei Ren et al.
Oncology research, 25(5), 789-798 (2016-12-17)
Long noncoding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) is involved in the development and carcinogenesis of various tumors, suggesting the diagnostic potential of TUG1 in these cancers. However, the exact role of TUG1 and its underlying mechanism in gastric cancer
Ying Ai et al.
International immunopharmacology, 86, 106703-106703 (2020-07-01)
Intrauterine adhesion (IUA) is one of the most common reproductive system diseases in women worldwide. The role of lncRNAs in multiple diseases has been confirmed, but the role and mechanism of lncRNA taurine upregulated gene 1 (TUG1) in the progression
T Xu et al.
European review for medical and pharmacological sciences, 23(11), 4698-4705 (2019-06-19)
To explore the correlation between plasma level of lncRNA TUG1 with PSA level, Gleason grading and tumor node metastasis (TNM) stage of prostate cancer (PCa) patients. This study aims to evaluate the potential diagnostic and prognostic values of TUG1 in
Xiaodi Liu et al.
Journal of cellular biochemistry (2019-03-06)
This study intended to investigate the potential molecular mechanism of long noncoding RNA (lncRNA) taurine upregulated gene 1 (TUG1) in the development of sepsis-associated acute kidney injury (AKI). The expression of TUG1 in the serum from patients with sepsis resulted
Pan Wang et al.
Journal of experimental & clinical cancer research : CR, 39(1), 7-7 (2020-01-11)
Long noncoding RNAs (lncRNAs) are involved in the progression of various cancers and affect the response to radiotherapy. This study focused on clarifying the underlying mechanism by which lncTUG1 affects the radiosensitivity of esophageal squamous cell carcinoma (ESCC). lncTUG1, miR-144-3p
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.