콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU130211

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDM1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCAGCTCTCCAATCTGAAGGTCCACCTGAGAGTGCACAGTGGAGAACGGCCTTTCAAATGTCAGACTTGCAACAAGGGCTTTACTCAGCTCGCCCACCTGCAGAAACACTACCTGGTACACACGGGAGAAAAGCCACATGAATGCCAGGTCTGCCACAAGAGATTTAGCAGCACCAGCAATCTCAAGACCCACCTGCGACTCCATTCTGGAGAGAAACCATACCAATGCAAGGTGTGCCCTGCCAAGTTCACCCAGTTTGTGCACCTGAAACTGCACAAGCGTCTGCACACCCGGGAGCGGCCCCACAAGTGCTCCCAGTGCCACAAGAACTACATCCATCTCTGTAGCCTCAAGGTTCACCTGAAAGGGAACTGCGCTGCGGCCCCGGCGCCTGGGCTGCCCTTGGAAGATCTGACCCGAATC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Enzo Acerbi et al.
Scientific reports, 6, 23128-23128 (2016-03-16)
T helper 17 (TH17) cells represent a pivotal adaptive cell subset involved in multiple immune disorders in mammalian species. Deciphering the molecular interactions regulating TH17 cell differentiation is particularly critical for novel drug target discovery designed to control maladaptive inflammatory
Liuluan Zhu et al.
Journal of hematology & oncology, 10(1), 124-124 (2017-06-21)
T cell immunoglobulin and immunoreceptor tyrosine-based inhibitory motif (ITIM) domain (TIGIT) and programmed cell death protein 1 (PD-1) are important inhibitory receptors that associate with T cell exhaustion in acute myeloid leukemia (AML). In this study, we aimed to determine
Woo-Shin Kim et al.
Scientific reports, 7(1), 10626-10626 (2017-09-08)
Transglutaminase 2 (TG2) performs multiple reactions, including transamidation, and also plays a role in signal transduction as a GTP-binding protein. In this study, we reveal that TG2 controls osteoclast differentiation and bone homeostasis in mice. Osteoclasts specifically expressed the TG2
Prontip Saelee et al.
Frontiers in immunology, 8, 383-383 (2017-04-26)
The transcription factor Ets1 is highly expressed in B lymphocytes. Loss of Ets1 leads to premature B cell differentiation into antibody-secreting cells (ASCs), secretion of autoantibodies, and development of autoimmune disease. Despite the importance of Ets1 in B cell biology
Zhuoming Liu et al.
The Journal of experimental medicine, 211(6), 1197-1213 (2014-05-28)
Competition for iron influences host-pathogen interactions. Pathogens secrete small iron-binding moieties, siderophores, to acquire host iron. In response, the host secretes siderophore-binding proteins, such as lipocalin 24p3, which limit siderophore-mediated iron import into bacteria. Mammals produce 2,5-dihydroxy benzoic acid, a

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.