설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGTTCTTGGGCATTTTGTCAGTGATGCTGATCTTTGCCTTCTTCCAGGAACTTGTAATAGCTGGCATCGTTGAGAATGAATGGAAAAGAACGTGCTCCAGACCCAAATCTAACATAGTTCTCCTGTCAGCAGAAGAAAAAAAAGAACAGACTATTGAAATAAAAGAAGAAGTGGTTGGGCTAACTGAAACATCTTCCCAACCAAAGAATGAAGAAGACATTGAAATTATTCCAATCCAAGAAGAGGAAGAAGAAGAAACAGAGACGAACTTTCCAGAACCTCCCCAAGATCAGGAATCCTCACCAATAGAAAATGACAGCTCTCCTTAAGTGATTTCTTCTGTTTTCTGTTTCCTTTTTTAAACATTAGTGTTCATAGCTTCCAAGAGACATGCTGACTTTCATTTCTTGAGGTACTCTGCACATACGCACCACATCTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MS4A1(931) , MS4A1(931)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Distribution of CD163-positive cell and MHC class II-positive cell in the normal equine uveal tract.
Yuto Sano et al.
The Journal of veterinary medical science, 78(2), 287-291 (2015-11-06)
Antigen-presenting cells (APCs) in the uveal tract participate in ocular immunity including immune homeostasis and the pathogenesis of uveitis. In horses, although uveitis is the most common ocular disorder, little is known about ocular immunity, such as the distribution of
Oriana Marques et al.
BMC cancer, 16, 187-187 (2016-03-06)
While the deregulation of iron homeostasis in breast epithelial cells is acknowledged, iron-related alterations in stromal inflammatory cells from the tumor microenvironment have not been explored. Immunohistochemistry for hepcidin, ferroportin 1 (FPN1), transferrin receptor 1 (TFR1) and ferritin (FT) was
Alessia Alunno et al.
Journal of cellular and molecular medicine, 19(7), 1689-1696 (2015-03-11)
It has been recently reported that telocytes, a stromal (interstitial) cell subset involved in the control of local tissue homeostasis, are hampered in the target organs of inflammatory/autoimmune disorders. Since no data concerning telocytes in minor salivary glands (MSGs) are
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.