콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU127961

Sigma-Aldrich

MISSION® esiRNA

targeting human NCF1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCCAGCCAGCACTATGTGTACATGTTCCTGGTGAAATGGCAGGACCTGTCGGAGAAGGTGGTCTACCGGCGCTTCACCGAGATCTACGAGTTCCATAAAACCTTAAAAGAAATGTTCCCTATTGAGGCAGGGGCGATCAATCCAGAGAACAGGATCATCCCCCACCTCCCAGCTCCCAAGTGGTTTGACGGGCAGCGGGCCGCCGAGAACCGCCAGGGCACACTTACCGAGTACTGCGGCACGCTCATGAGCCTGCCCACCAAGATCTCCCGCTGTCCCCACCTCCTCGACTTCTTCAAGGTGCGCCCTGATGACCTCAAGCTCCCCACGGACAACCAGACAAAAAAGCCAGAGACATACTTGATGCCCAAAGATGGCAAGAGTACCGCGACAGACATCA

Ensembl | 인체 수납 번호

ENSG00000158517

NCBI 수납 번호

NM_000265

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NCF1(653361) , NCF1(653361)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
IVR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bharatwaj Sowrirajan et al.
Scientific reports, 7, 43441-43441 (2017-02-28)
Interleukin (IL)-27, a member of the IL-12 cytokine family, plays an important and diverse role in the function of the immune system. We have previously demonstrated that IL-27 is an anti-viral cytokine which inhibits HIV-1, HIV-2, Influenza virus and herpes
Tian Wang et al.
Biochemical and biophysical research communications, 489(4), 361-368 (2017-05-10)
In acute lung injury/acute respiratory distress syndrome (ALI/ARDS), pathogenesis is associated with the regulation of macrophage-generated oxidative stress, and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-derived reactive oxygen species(ROS) are key to regulating oxidative stress. In the present study, we
Dehong Yan et al.
The Journal of experimental medicine, 217(2) (2019-10-31)
Myeloid-derived suppressor cells (MDSCs) are "polarized" myeloid cells that effectively promote tumorigenesis by inhibiting antitumor immunity. How myeloid cells acquire the protumoral properties during tumorigenesis is poorly understood. We report here that the polarity protein TIPE2 (tumor necrosis factor-α-induced protein
Matthew R DiStasi et al.
American journal of physiology. Heart and circulatory physiology, 306(10), H1435-H1443 (2014-03-19)
The role of NADPH oxidase (Nox) in both the promotion and impairment of compensatory collateral growth remains controversial because the specific Nox and reactive oxygen species involved are unclear. The aim of this study was to identify the primary Nox

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.