설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GACTGATTTGGGGGACATTGTACAGTGAGTGAAGTATAGCCTTTATGCCACACTCTGTGGCCCTAAAATGGTGAATCAGAGCATATCTAGTTGTCTCAACCCTTGAAGCAATATGTATTATAAACTCAGAGAACAGAAGTGCAATGTGATGGGAGGAACATAGCAATATCTGCTCCTTTTCGAGTTGTTTGAGAAATGTAGGCTATTTTTTCAGTGTATATCCACTCAGATTTTGTGTATTTTTGATGTACACTGTTCTCTAAATTCTGAATCTTTGGGAAAAAATGTAAAGCATTTATGATCTCAGAGGTTAACTTATTTAAGGGGGATGTACATATATTCTCTGAAACTAGGATGCATGCAATTGTGTTGGAAGTGTCCTTGGTGCCTTGTGTGATGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... EGR2(1959) , EGR2(1959)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
European review for medical and pharmacological sciences, 24(9), 4890-4900 (2020-05-21)
Various microRNAs (miRNAs) have been reported to be involved in the pathogenesis and development of human cancers, including papillary thyroid carcinoma (PTC). However, the role of miR-224-5p in PTC progression remains unclear. Therefore, the purpose of this study is to
Oncotarget, 8(49), 86217-86226 (2017-11-22)
Cervical cancer is the second leading cause of mortality among women. Impairment of the base excision repair (BER) pathway is one of the major causes of the initiation and progression of cervical cancer. However, whether the polymorphisms of the BER
Acta biochimica et biophysica Sinica, 47(6), 431-440 (2015-05-04)
Non-small-cell lung cancer (NSCLC) is one of the most common lung cancers, and microRNAs (miRNAs) have been reported to play essential roles in NSCLC. Recent studies have indicated that miR-330-3p expression is up-regulated in NSCLC samples and in tissues of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.