콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU124131

Sigma-Aldrich

MISSION® esiRNA

targeting human PKN1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGTCACCTCTGACCCTCGAAGATTTCAAGTTCCTGGCGGTGCTGGGCCGGGGTCATTTTGGGAAGGTGCTCCTCTCCGAATTCCGGCCCAGTGGGGAGCTGTTCGCCATCAAGGCTCTGAAGAAAGGGGACATTGTGGCCCGAGACGAGGTGGAGAGCCTGATGTGTGAGAAGCGGATATTGGCGGCAGTGACCAGTGCGGGACACCCCTTCCTGGTGAACCTCTTCGGCTGTTTCCAGACACCGGAGCACGTGTGCTTCGTGATGGAGTACTCGGCCGGTGGGGACCTGATGCTGCACATCCACAGCGACGTGTTCTCTGAGCCCCGTGCCATCTTTTATTCCGCCTGCGTGGTGCTGGGCCTACAGTTTCTTCACGAACACAAGATCGTCTACAGGGACCTGAAGTTGGACAATTTGCTCCTGGACACC

Ensembl | 인체 수납 번호

ENSG00000123143

NCBI 수납 번호

NM_002741

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PKN1(5585) , PKN1(5585)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Guiling Wang et al.
Oncotarget, 6(12), 9877-9886 (2015-04-19)
To date, microrchidia (MORC) family CW-type zinc-finger 2 (MORC2), has been found to be involved in p21-activated kinase1 (PAK1) pathway to maintain genomic integrity. Here, we explore its novel role in cancer. We demonstrate that PAK1-mediated MORC2 phosphorylation promotes cell
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell
Alexandre K Rouquette-Jazdanian et al.
PloS one, 10(6), e0131823-e0131823 (2015-06-30)
Linker for Activation of T cells (LAT) is an adapter protein that is essential for T cell function. Knock-in mice with a LAT mutation impairing calcium flux develop a fatal CD4+ lymphoproliferative disease. miR-155 is a microRNA that is correlated

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.