설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGCACCCCTACTTCCAAGAACAGAGGAAAACAGAGAAGCGGGCTCTGGGCAGCCACAGAAAAGCTGGCTTTCCGGAGCACCCTGTGGCACCGGAACCACTCAGTAACAGCTGCCAGATTTCCAAGGAGGGCAGAAAGCAGAAACAGTCCCTAAAGCAAGAGGAGGACCGTCCCAAGAGACGAGGACCGGCCTATGTCATGGAACTGCCCAAACTAAAGCTTTCGGGAGTGGTCAGACTGTCGTCTTACTCCAGCCCCACGCTGCAGTCCGTGCTTGGATCTGGAACAAATGGAAGAGTGCCGGTGCTGAGACCCTTGAAGTGCATCCCTGCGAGCAAGAAGACAGATCCGCAGAAGGACCTTAAGCCTGCCCCGCAGCAGTGTCGCCTGCCCACCATAGTGCGGAAAGGCGGAAGATAACTGAGCAGCACCG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MOK(5891) , RAGE(5891)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Wenbin Ye et al.
Apoptosis : an international journal on programmed cell death, 22(1), 86-97 (2016-11-20)
This study aimed to investigate the effect of AOPPs on apoptosis in human chondrocytes. Chondrocytes were treated with AOPPs. Cell death, nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activity, reactive oxygen species (ROS) generation, and the expression of apoptotic proteins were
Bikesh K Nirala et al.
Diabetes & vascular disease research, 12(4), 290-297 (2015-05-13)
Pro-inflammatory conditions induced by products of protein glycation in diabetes substantially enhance the risk of endothelial dysfunction and related vascular complications. Endothelial cell specific molecule-1 (ESM-1) or endocan has been demonstrated as a potential biomarker in cancer and sepsis. Its
Yosuke Kanno et al.
Arthritis research & therapy, 22(1), 76-76 (2020-04-11)
Fibrotic diseases are characterized by tissue overgrowth, hardening, and/or scarring because of the excessive production, deposition, and contraction of the extracellular matrix (ECM). However, the detailed mechanisms underlying these disorders remain unclear. It was recently reported that α2-antiplasmin (α2AP) is
Yan Xia Yu et al.
American journal of translational research, 9(6), 2760-2774 (2017-07-04)
Non-small cell lung cancer (NSCLC) constitutes the main cases of lung cancer and is the world's most common and lethal cancer owing to regional invasion or distant metastasis. Growing morbidity and lethality demonstrates that valid molecular target in management of
Jing Zhou et al.
BioMed research international, 2018, 1650456-1650456 (2018-11-08)
Intermittent hypoxia (IH) that resulted from obstructive sleep apnea (OSA) has been found to be a risk factor of coronary artery disease. IH and the receptor for advanced glycation end products (RAGE) expression are known to activate monocyte/macrophage and associated
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.