콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU123061

Sigma-Aldrich

MISSION® esiRNA

targeting human AFDN

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCTGGGCCTGAGCTGATACTACCTGCAAGCATTGAATTCAGGGAAAGTTCTGAAGATTCATTTTTGTCTGCCATTATAAATTATACTAATAGCTCTACAGTCCACTTTAAGTTGTCCCCTACATATGTATTATATATGGCATGCCGGTATGTATTGTCCAACCAGTACAGACCTGACATCAGCCCTACAGAGCGCACACATAAAGTCATTGCAGTCGTCAACAAGATGGTGAGCATGATGGAGGGTGTCATCCAGAAACAGAAGAATATTGCAGGGGCACTTGCCTTCTGGATGGCAAATGCATCTGAACTTCTCAACTTCATTAAGCAAGACCGAGACCTTAGTCGGATCACACTGGATGCTCAAGATGTTTTAGCACATTTGGTTCAAATGGCATTTAAATACTTGGTTCACTGTCTTCAATCAGAACTTAATAATTACATGCCAGCCTTTCTAGATG

Ensembl | 인체 수납 번호

ENSG00000130396

NCBI 수납 번호

NM_001040000

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... AFDN(4301) , MLLT4(4301)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Paul Ugalde-Silva et al.
MicrobiologyOpen, 8(12), e931-e931 (2019-10-01)
Enteropathogenic Escherichia coli (EPEC) infection causes a histopathological lesion including recruitment of F-actin beneath the attached bacteria and formation of actin-rich pedestal-like structures. Another important target of EPEC is the tight junction (TJ), and EspF induces displacement of TJ proteins
Haruko Tsurumi et al.
Laboratory investigation; a journal of technical methods and pathology, 96(1), 49-59 (2015-11-17)
In kidney glomeruli, mesangial cells provide structural support to counteract for expansile forces caused by pressure gradients and to regulate the blood flow. Glomerular injury results in proliferation and aberrant migration of mesangial cells, which is the pathological characteristic of
Takuro Yamamoto et al.
BMC cancer, 15, 275-275 (2015-04-17)
AF-6/afadin plays an important role in the formation of adherence junctions. In breast and colon cancer, loss of AF-6/afadin induces cell migration and cell invasion. We aimed to elucidate the role of AF-6/afadin in human endometrial cancer. Morphology and AF-6/afadin

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.