콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU121641

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD7

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCTGGCCTGCTACTTCTACGAGCAGGCCTTCCGCGAGCACTGGGAGCGCACCTGGCTCCTGCAGACGTGCAAGAGCTATGCCGTGCCCTGCCCGCCCGGCCACTTCCCGCCCATGAGCCCCGACTTCACCGTCTTCATGATCAAGTACCTGATGACCATGATCGTCGGCATCACCACTGGCTTCTGGATCTGGTCGGGCAAGACCCTGCAGTCGTGGCGCCGCTTCTACCACAGACTTAGCCACAGCAGCAAGGGGGAGACTGCGGTATGAGCCCCGGCCCCTCCCCACCTTTCCCACCCCAGCCCTCTTGCAAGAGGAGAGGCACGGTAGGGAAAAGAACTGCTGGGTGGGGGCCTGTTTCTGTAACTTTCTCCCCCTCTACTGAGAAGTGACCTGGAAGTGAGAAGTTCTTTGCAGATTTGGGGCGAGGGGTGATTTGGAAAAGAAGACCTGGGTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yan Geng et al.
Oncology reports, 35(4), 2441-2450 (2016-01-20)
MicroRNAs (miRNAs) are novel tools for cancer therapy. Frizzled7 (FZD7) is an important co-receptor in the WNT signaling pathway. The WNT signaling pathway is aberrantly activated in Helicobacter pylori (H. pylori)‑infected gastric cancer cells. However, the role of FZD7 in
Yufeng Wang et al.
Cell death & disease, 9(9), 851-851 (2018-08-30)
Previous evidences reveal that long non-coding RNA (lncRNA) down syndrome critical region 8 (DSCR8) involves in the progression of multiple cancers. However, the exact expression, function, and mechanism of DSCR8 in hepatocellular carcinoma (HCC) remain uncovered. In this study, real-time
M Asad et al.
Cell death & disease, 5, e1346-e1346 (2014-07-18)
Ovarian cancer (OC) can be classified into five biologically distinct molecular subgroups: epithelial-A (Epi-A), Epi-B, mesenchymal (Mes), Stem-A and Stem-B. Among them, Stem-A expresses genes relating to stemness and is correlated with poor clinical prognosis. In this study, we show
Salvatore Condello et al.
Cancer research, 78(11), 2990-3001 (2018-03-08)
Cancer progression and recurrence are linked to a rare population of cancer stem cells (CSC). Here, we hypothesized that interactions with the extracellular matrix drive CSC proliferation and tumor-initiating capacity and investigated the functions of scaffold protein tissue transglutaminase (TG2)
Liang-Jie Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 314-326 (2018-07-07)
Migration of placental extravillous trophoblast (EVT) cells into uterine decidua facilitates the establishment of blood circulation between mother and fetus and is modulated by EVT-decidual cell interaction. Poor or excessive EVT migration is associated with pregnancy complications such as preeclampsia

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.