콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU119251

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF15

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGAACTTCTCGTCGCCAAAATGCCCAGTTGGGTATCTGGGTGATAGGCTGGTTGGCCGGCGGGCATATCACATGCTGCCCTCACCCGTCTCTGAAGATGACAGCGATGCCTCCAGCCCCTGCTCCTGTTCCAGTCCCGACTCTCAAGCCCTCTGCTCCTGCTATGGTGGAGGCCTGGGCACCGAGAGCCAGGACAGCATCTTGGACTTCCTATTGTCCCAGGCCACGCTGGGCAGTGGCGGGGGCAGCGGCAGTAGCATTGGGGCCAGCAGTGGCCCCGTGGCCTGGGGGCCCTGGCGAAGGGCAGCGGCCCCTGTGAAGGGGGAGCATTTCTGCTTGCCCGAGTTTCCTTTGGGTGATCCTGATGACGTCCCACGGCCCTTCCAGCCTACCCTGGAGGAGATTGAAGAGTTTCTGGAGGAGAACATGGAGCCTGGAGTCAAGGAGGTCCCTGAGGGCAACAGCAAGGACTTGGATGCCTGCAGCCAGCTCTCAGCTGGGCCACACAAGAGCCACCTCCATC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Mi-Yeon Yu et al.
Experimental cell research, 386(1), 111706-111706 (2019-11-08)
Krüppel-like factor 15 (KLF15) is a well-known transcription factor associated with podocyte injury and fibrosis. Recently, hypertensive nephropathy was discovered to be closely related to podocyte injury and fibrosis. However, methods to stimulate hypertension in vitro are lacking. Here, we
Deepesh Pandey et al.
Arteriosclerosis, thrombosis, and vascular biology, 38(4), 913-926 (2018-02-24)
KLF15 (Kruppel-like factor 15) has recently been shown to suppress activation of proinflammatory processes that contribute to atherogenesis in vascular smooth muscle, however, the role of KLF15 in vascular endothelial function is unknown. Arginase mediates inflammatory vasculopathy and vascular injury
Seung Seok Han et al.
International journal of molecular medicine, 42(3), 1593-1602 (2018-06-15)
Krüppel‑like factor 15 (KLF15), also known as kidney‑enriched transcription factor, is known to participate in podocyte differentiation. However, the role of KLF15 in chronic podocyte injury remains incompletely understood, particularly in proteinuric disease models. In the present study, the 5/6 nephrectomy
Peter O Oladimeji et al.
Biochemical pharmacology, 160, 92-109 (2018-12-20)
The pregnane X receptor (PXR) is a principal xenobiotic receptor crucial in the detection, detoxification, and clearance of toxic substances from the body. PXR plays a vital role in the metabolism and disposition of drugs, and elevated PXR levels contribute to cancer

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.