콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU115801

Sigma-Aldrich

MISSION® esiRNA

targeting human GSTM1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTGAAGGCCAGGAGGTGGGAGTGAGGAGCCCATACTCAGCCTGCTGCCCAGGCTGTGCAGCGCAGCTGGACTCTGCATCCCAGCACCTGCCTCCTCGTTCCTTTCTCCTGTTTATTCCCATCTTTACTCCCAAGACTTCATTGTCCCTCTTCACTCCCCCTAAACCCCTGTCCCATGCAGGCCCTTTGAAGCCTCAGCTACCCACTATCCTTCGTGAACATCCCCTCCCATCATTACCCTTCCCTGCACTAAAGCCAGCCTGACCTTCCTTCCTGTTAGTGGTTGTGTCTGCTTTAAAGGGCCTGCCTGGCCCCTCGCCTGTGGAGCTCAGCCCCGAGCTGTCCCCGTGTTGCATGAAGGAGCAGCATTGACTGGT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Pritha Bhattacharjee et al.
Scientific reports, 3, 2704-2704 (2013-09-21)
The gene for glutathione-S-transferase (GST) M1 (GSTM1), a member of the GST-superfamily, is widely studied in cancer risk with regard to the homozygous deletion of the gene (GSTM1 null), leading to a lack of corresponding enzymatic activity. Many of these
Yi Lu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 120, 109532-109532 (2019-10-13)
Reactive oxygen species (ROS) are implicated in carcinogenesis, and cellular antioxidant systems are important for detoxifying ROS and reversing oxidant-mediated modifications. Glutathione S-transferase mu (GSTM) belongs to a family of phase II detoxification enzymes that catalyze the conjugation of reduced
Weidong Wu et al.
Particle and fibre toxicology, 9, 31-31 (2012-08-08)
Diesel exhaust particles (DEP) contribute substantially to ambient particulate matter (PM) air pollution in urban areas. Inhalation of PM has been associated with increased incidence of lung disease in susceptible populations. We have demonstrated that the glutathione S-transferase M1 (GSTM1)

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.