설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTGAAGGCCAGGAGGTGGGAGTGAGGAGCCCATACTCAGCCTGCTGCCCAGGCTGTGCAGCGCAGCTGGACTCTGCATCCCAGCACCTGCCTCCTCGTTCCTTTCTCCTGTTTATTCCCATCTTTACTCCCAAGACTTCATTGTCCCTCTTCACTCCCCCTAAACCCCTGTCCCATGCAGGCCCTTTGAAGCCTCAGCTACCCACTATCCTTCGTGAACATCCCCTCCCATCATTACCCTTCCCTGCACTAAAGCCAGCCTGACCTTCCTTCCTGTTAGTGGTTGTGTCTGCTTTAAAGGGCCTGCCTGGCCCCTCGCCTGTGGAGCTCAGCCCCGAGCTGTCCCCGTGTTGCATGAAGGAGCAGCATTGACTGGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GSTM1(2944) , GSTM1(2944)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Pritha Bhattacharjee et al.
Scientific reports, 3, 2704-2704 (2013-09-21)
The gene for glutathione-S-transferase (GST) M1 (GSTM1), a member of the GST-superfamily, is widely studied in cancer risk with regard to the homozygous deletion of the gene (GSTM1 null), leading to a lack of corresponding enzymatic activity. Many of these
Yi Lu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 120, 109532-109532 (2019-10-13)
Reactive oxygen species (ROS) are implicated in carcinogenesis, and cellular antioxidant systems are important for detoxifying ROS and reversing oxidant-mediated modifications. Glutathione S-transferase mu (GSTM) belongs to a family of phase II detoxification enzymes that catalyze the conjugation of reduced
Weidong Wu et al.
Particle and fibre toxicology, 9, 31-31 (2012-08-08)
Diesel exhaust particles (DEP) contribute substantially to ambient particulate matter (PM) air pollution in urban areas. Inhalation of PM has been associated with increased incidence of lung disease in susceptible populations. We have demonstrated that the glutathione S-transferase M1 (GSTM1)
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.