추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGAAAACGAACCCATCCTCTATGGTCGGAGCTACACTTGGCTGTGCTATGAAGTGAAAATAAAGAGGGGCCGCTCAAATCTCCTTTGGGACACAGGGGTCTTTCGAGGCCAGGTGTATTTCAAGCCTCAGTACCACGCAGAAATGTGCTTCCTCTCTTGGTTCTGTGGCAACCAGCTGCCTGCTTACAAGTGTTTCCAGATCACCTGGTTTGTATCCTGGACCCCCTGCCCGGACTGTGTGGCGAAGCTGGCCGAATTCCTGTCTGAGCACCCCAATGTCACCCTGACCATCTCTGCCGCCCGCCTCTACTACTACTGGGAAAGAGATTACCGAAGGGCGCTCTGCAGGCTGAGTCAGGCAGGAGCCCGCGTGACGATCATGGACTATGAAGAATTTGCATACTGCTGGGAAAACTTTGTGTACAATGAAGGTCAGCAATTCATGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... APOBEC3B(9582) , APOBEC3B(9582)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Qiu-Ping Jia et al.
Cancer chemotherapy and pharmacology, 83(4), 625-637 (2019-01-12)
Compelling evidence establishes the etiological role of viral proteins E6 and E7 of high-risk human papillomaviruses (HPV) in cervical carcinogenesis, but their contribution in chemoresistance that leads to advanced metastatic lesions remains poorly defined. Since metastasis-associated protein 1 (MTA1) upregulation
Min Gwak et al.
Tumori, 100(4), 112e-117e (2014-10-10)
APOBEC3B is a deaminase that possesses DNA C-to-T editing activity. A recent report showed that APOBEC3B mRNA was overexpressed in breast cancer and that its expression was responsible for the high C-to-T mutation spectrum in breast cancer, suggesting that APOBEC3B
Yanmeng Chen et al.
Antiviral research, 149, 16-25 (2017-11-14)
Hepatitis B virus is a partially double-stranded DNA virus that replicates by reverse transcription, which occurs within viral core particles in the cytoplasm. The cytidine deaminase APOBEC3B is a cellular restriction factor for HBV. Recently, it was reported that APOBEC3B
Jian Zhang et al.
International journal of clinical and experimental pathology, 8(5), 5089-5096 (2015-07-21)
Gastric cancer was the third cause of death in China. In this study, we found that the APOBEC3 (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3) expression was higher in gastric cancer tissues than that in normal tissues and confirmed APOBEC3B
Zhe Jin et al.
Oncology reports, 32(5), 1867-1872 (2014-09-02)
Chondrosarcomas rank as the third most common type of bone tumors. In the present study, we demonstrated that expression of the apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) was higher in cancer tissues when compared to that in normal tissues. In
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.