콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU113921

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG4B

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCAGCCAGACAGCTACTTCAGCGTCCTCAACGCATTCATCGACAGGAAGGACAGTTACTACTCCATTCACCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCCATAGGCCAGTGGTACGGGCCCAACACTGTCGCCCAGGTCCTGAAGAAGCTTGCTGTCTTCGATACGTGGAGCTCCTTGGCGGTCCACATTGCAATGGACAACACTGTTGTGATGGAGGAAATCAGAAGGTTGTGCAGGACCAGCGTTCCCTGTGCAGGCGCCACTGCGTTTCCTGCAGATTCCGACCGGCACTGCAACGGATTCCCTGCCGGAGCTGAGGTCACCAACAGGCCGTCGCCATGGAGACCCCTGGTACTTCTCATTCCCCTGCGCCTGGGGCTCACGGACATCAACGAGGCCTACGT

Ensembl | 인체 수납 번호

ENSG00000168397

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ATG4B(23192) , ATG4B(23192)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yao-Xin Lin et al.
Biomaterials, 141, 199-209 (2017-07-10)
Autophagic therapy is regarded as a promising strategy for disease treatment. Appropriate autophagy regulations in vivo play a crucial role in translating this new concept from benchside to bedside. So far, emerging technologies are required to spatially and quantitatively monitor autophagic
Yao-Xin Lin et al.
ACS nano, 11(2), 1826-1839 (2017-01-24)
Autophagy plays a crucial role in the metabolic process. So far, conventional methods are incapable of rapid, precise, and real-time monitoring of autophagy in living objects. Herein, we describe an in situ intracellular self-assembly strategy for quantitative and temporal determination
Tianzhi Huang et al.
Cancer cell, 32(6), 840-855 (2017-12-13)
ATG4B stimulates autophagy by promoting autophagosome formation through reversible modification of ATG8. We identify ATG4B as a substrate of mammalian sterile20-like kinase (STK) 26/MST4. MST4 phosphorylates ATG4B at serine residue 383, which stimulates ATG4B activity and increases autophagic flux. Inhibition
Pei-Feng Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 728-740 (2017-11-24)
ATG4B is a cysteine protease required for autophagy, which is a cellular catabolic pathway involved in energy balance. ATG4B expression is elevated during tumor growth in certain types of cancer, suggesting that ATG4B is an attractive target for cancer therapy.
Elisabeth Corcelle-Termeau et al.
Autophagy, 12(5), 833-849 (2016-04-14)
Sphingomyelin is an essential cellular lipid that traffics between plasma membrane and intracellular organelles until directed to lysosomes for SMPD1 (sphingomyelin phosphodiesterase 1)-mediated degradation. Inactivating mutations in the SMPD1 gene result in Niemann-Pick diseases type A and B characterized by
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.