콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU113611

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXO3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TATGCAAACCCTCTCGGACTCTCTCTCAGGCTCCTCCTTGTACTCAACTAGTGCAAACCTGCCCGTCATGGGCCATGAGAAGTTCCCCAGCGACTTGGACCTGGACATGTTCAATGGGAGCTTGGAATGTGACATGGAGTCCATTATCCGTAGTGAACTCATGGATGCTGATGGGTTGGATTTTAACTTTGATTCCCTCATCTCCACACAGAATGTTGTTGGTTTGAACGTGGGGAACTTCACTGGTGCTAAGCAGGCCTCATCTCAGAGCTGGGTGCCAGGCTGAAGGATCACTGAGGAAGGGGAAGTGGGCAAAGCAGACCCTCAAACTGACACAAGACCTACAGAGAAAACCCTTTGCCAAATCTGCTCTCAGCAAGTGGACAGTGATACCGTTTACAGCTTAACACCTTTGTGAATCCCACGCCATTTTCCTAACCCAGCAGAGACTGTTAATGGCCC

Ensembl | 인체 수납 번호

ENSG00000118689

NCBI 수납 번호

NM_001455

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FOXO3(2309) , FOXO3(2309)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
BDV
JBV
GXU
WIT
HQS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ning Liu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 66(7), 603-610 (2017-04-13)
Fibroblast-like synoviocytes (FLS) play an essential role in the pathogenesis of chronic inflammatory diseases, such as rheumatoid arthritis. Paeonol (Pae) is a phenolic compound found in many traditional Chinese medicine remedies. However, the effects of Pae on TNF-α-stimulated FLS and
M Kumazoe et al.
Oncogene, 36(19), 2643-2654 (2016-11-29)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most fatal types of cancer and the 5-year survival rate is only 5%. Several studies have suggested that cancer stem cells (CSCs) are thought to be involved in recurrence and metastasis and
Yanqiu Wang et al.
Biochemical and biophysical research communications, 524(3), 756-763 (2020-02-10)
Intervertebral disc degeneration (IDD) is typically accompanied by a reduced nutrient supply, which is thought to be a contributor to the apoptosis of nucleus pulposus cells (NPCs). Here, we explored whether Forkhead box O3 (FOXO3), a key transcription factor involved
Jangsoon Lee et al.
Breast cancer research and treatment, 146(2), 259-272 (2014-06-12)
Although there are effective HER2-targeted agents, novel combination strategies in HER2-overexpressing breast cancers are needed for patients whose tumors develop drug resistance. To develop new therapeutic strategy, we investigated the combinational effect of entinostat, an oral isoform-selective histone deacetylase type
Fei Wang et al.
Folia histochemica et cytobiologica, 58(1), 1-8 (2020-02-01)
Osteoarthritis (OA) is the most common degenerative disease in middle-aged and elderly individuals that causes joint deformity and limb disability. Accumulating evidence has suggested that the pathogenesis of OA has been related to various mechanisms such as apoptosis, inflammation, oxidative
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.