콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU112591

Sigma-Aldrich

MISSION® esiRNA

targeting human MT2A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ACCACGCCTCCTCCAAGTCCCAGCGAACCCGCGTGCAACCTGTCCCGACTCTAGCCGCCTCTTCAGCTCGCCATGGATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCAAAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGATGCTGGGACAGCCCCGCTCCCAGATGTAAAGAACGCGACTTCCACAAACCTGGATTTTTTATGTACAACCCTGACCGTGACCGTTTGCTATATTCC

Ensembl | 인체 수납 번호

ENSG00000125148

NCBI 수납 번호

NM_005953

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... MT2A(4502) , MT2A(4502)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Weiling Leng et al.
International journal of inflammation, 2015, 301562-301562 (2016-02-18)
Our research group firstly discovered endothelial-overexpressed lipopolysaccharide-associated factor 1 (EOLA1, GenBank number AY074889) as a lipopolysaccharide (LPS) responsive gene in ECV304 cells. The previous studies have further demonstrated the association of EOLA1 with metallothionein 2A (MT2A), while the role of
Youn Hee Park et al.
Journal of neuroinflammation, 10, 21-21 (2013-02-05)
Hypothermic protection against ischemic stroke has been reported by many studies. Hypothermia is supposed to mitigate the effects of deleterious genes and proteins and promote the activity of protective genes and proteins in the ischemic brain. Metallothionein (MT)-1/2 is thought
HanLin Ma et al.
Scientific reports, 5, 15121-15121 (2015-10-13)
We previously found that Homeobox containing 1 (HMBOX1) was required for bone mesenchymal stem cell (BMSC) and mouse embryonic stem cell (ESC) differentiation into vascular endothelial cells (VECs). However, the function of HMBOX1 in VECs is still unknown. In this
João Rafael Habib Souza Aquime et al.
Cells, 9(1) (2020-01-16)
Mucoepidermoid carcinoma (MEC) is the most common tumor in the salivary glands, often presenting with recurrence and metastasis due to its high invasive capacity. Metallothionein (MT), a zinc storage protein that supplies this element for protease activity, is probably related
N Habel et al.
Cell death & disease, 4, e874-e874 (2013-10-26)
Osteosarcoma is the most common primary tumor of bone occurring in children and adolescents. The histological response to chemotherapy represents a key clinical factor related to survival. We previously showed that statins exhibit antitumor effects in vitro, inducing apoptotic cell

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.