설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTTCCCAGCTCTGGCTTTTTGAAAGCAAAGATGAGCAACACTCAAGCTGAGAGGTCCATAATAGGCATGATCGACATGTTTCACAAATACACCAGACGTGATGACAAGATTGAGAAGCCAAGCCTGCTGACGATGATGAAGGAGAACTTCCCCAACTTCCTTAGTGCCTGTGACAAAAAGGGCACAAATTACCTCGCCGATGTCTTTGAGAAAAAGGACAAGAATGAGGATAAGAAGATTGATTTTTCTGAGTTTCTGTCCTTGCTGGGAGACATAGCCACAGACTACCACAAGCAGAGCCATGGAGCAGCGCCCTGTTCCGGGGGCAGCCAGTGACCCAGCCCCACCAATGGGCCTCCAGAGACCCCAGGAACAAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... S100A7(6278) , S100A7(6278)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Cancer gene therapy, 23(11), 382-391 (2016-10-22)
Oral cancer consists of squamous cell carcinoma within the oral cavity or on the lip. The clinical prognosis of this cancer is mostly poor owing to delayed diagnosis and a lack of appropriate early detection biomarkers to identify the disease.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.