추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACTTCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTGGATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAGGCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAAACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAGGCGGCTTTGGCGGTGGTAGTGGTAGCAATTTTGGAGGTGGTGGAAGCTAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HNRNPA1(3178) , HNRNPA1(3178)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Cheng-Kai Chang et al.
PloS one, 12(11), e0188214-e0188214 (2017-11-18)
The viral ribonucleoprotein (vRNP) of influenza A virus is formed by virion RNA (vRNA), viral polymerase complex, and nucleoprotein (NP). The NP plays an important role in facilitating the replication and stabilization of viral RNA. To explore host factors that
Mariana D Mandler et al.
Nucleic acids research, 42(11), 7319-7329 (2014-05-06)
The selective RNA-binding protein quaking I (QKI) plays important roles in controlling alternative splicing (AS). Three QKI isoforms are broadly expressed, which display distinct nuclear-cytoplasmic distribution. However, molecular mechanisms by which QKI isoforms control AS, especially in distinct cell types
Mei-Ling Li et al.
Methods (San Diego, Calif.), 183, 13-20 (2020-02-23)
Enterovirus A71 (EV-A711) RNA contains an internal ribosomal entry site (IRES) to direct cap-independent translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs). We previously showed that hnRNP A1, the mRNA stability factor HuR, and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.