콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU111231

Sigma-Aldrich

MISSION® esiRNA

targeting human ACTA2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCC

Ensembl | 인체 수납 번호

ENSG00000107796

NCBI 수납 번호

NM_001613

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ACTA2(59) , ACTA2(59)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ling Li et al.
BMC microbiology, 8, 26-26 (2008-02-08)
Porphyromonas gingivalis is associated with periodontal disease and invades different cell types including epithelial, endothelial and smooth muscle cells. In addition to P. gingivalis DNA, we have previously identified live invasive bacteria in atheromatous tissue. However, the mechanism of persistence
Melissa A Kinney et al.
Scientific reports, 4, 4290-4290 (2014-03-07)
Stem cell fate and function are dynamically modulated by the interdependent relationships between biochemical and biophysical signals constituting the local 3D microenvironment. While approaches to recapitulate the stem cell niche have been explored for directing stem cell differentiation, a quantitative
Charlotte Thålin et al.
Thrombosis research, 139, 56-64 (2016-02-27)
Large elevations of high sensitive Troponin T (hsTnT) in ischemic stroke patients is associated with a poor outcome. In a pilot study we found a high prevalence of malignancies among these patients. Since neutrophil extracellular traps (NETs) have been linked
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it
Omar Khalid et al.
PloS one, 11(3), e0150850-e0150850 (2016-03-18)
Cardiovascular disease, a progressive manifestation of α-L-iduronidase deficiency or mucopolysaccharidosis type I, continues in patients both untreated and treated with hematopoietic stem cell transplantation or intravenous enzyme replacement. Few studies have examined the effects of α-L-iduronidase deficiency and subsequent glycosaminoglycan
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.