설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CCATTGCCCTCTTGAACATTTACCGTAACCCTCAAAACTCTTCCCAGTCTGCTGACGGTTTGCGCTGTGCCGTGAGCGATGTGGAGATGCAGGAACACTATGATGAGTTTTTTGAGGAGGTTTTTACAGAAATGGAGGAGAAGTATGGGGAAGTAGAGGAGATGAACGTCTGTGACAACCTGGGAGACCACCTGGTGGGGAACGTGTACGTCAAGTTTCGCCGTGAGGAAGATGCGGAAAAGGCTGTGATTGACTTGAATAACCGTTGGTTTAATGGACAGCCGATCCACGCCGAGCTGTCACCCGTGACGGACTTCAGAGAAGCCTGCTGCCGTCAGTATGAGATGGGAGAATGCACACGAGGCGGCTTCTGCAACTTCATGCATTTGAAGCCCATTTCCAGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... U2AF1(102724594) , U2AF1(7307)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Olga Herdt et al.
RNA (New York, N.Y.), 23(12), 1796-1806 (2017-09-13)
Recent work has identified cancer-associated U2AF35 missense mutations in two zinc-finger (ZnF) domains, but little is known about Q157R/P substitutions within the second ZnF. Surprisingly, we find that the c.470A>G mutation not only leads to the Q157R substitution, but also
Gabriela Vazquez Rodriguez et al.
Frontiers in oncology, 10, 598684-598684 (2020-12-18)
The majority of estrogen receptor positive (ER+) breast cancer (BC) maintain the ER at metastatic sites. Despite anti-estrogen therapy, almost 30% of ER+ BC patients relapse. Thus, new therapeutic targets for ER+ BC are needed. Amino acids (AAs) may affect
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.