콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU109691

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTATGAAGCCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAATGGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTCCAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGTCCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAACACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACTGTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAA

Ensembl | 인체 수납 번호

ENSG00000044574

NCBI 수납 번호

NM_005347

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... HSPA5(3309) , HSPA5(3309)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
BBV
VNU
YJU
VFU
QEU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Patricia Dauer et al.
Molecular oncology, 12(9), 1498-1512 (2018-05-09)
Chemoresistance is a major therapeutic challenge that plays a role in the poor statistical outcomes in pancreatic cancer. Unfolded protein response (UPR) is one of the homeostasis mechanisms in cancer cells that have been correlated with chemoresistance in a number
Kyung-Won Park et al.
Scientific reports, 7, 44723-44723 (2017-03-24)
Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein
Jijun Wang et al.
Neurochemical research, 43(9), 1736-1744 (2018-07-02)
A growing body of literature has established a link between the cerebral ischaemic injury and pathological state of Alzheimer's disease (AD), and this correlation indicated that the preventive agent for ischaemia might improve the pathology of AD. Our previous studies
Haopeng Yang et al.
Oncotarget, 7(50), 83641-83656 (2016-11-16)
Pancreatic cancer is a highly aggressive malignancy, which is intrinsically resistant to current chemotherapies. Herein, we investigate whether bisdemethoxycurcumin (BDMC), a derivative of curcumin, potentiates gemcitabine in human pancreatic cancer cells. The result suggests that BDMC sensitizes gemcitabine by inducing
Hiroshi Kokubun et al.
International journal of molecular sciences, 21(2) (2020-01-16)
Preclinical studies have shown that exposure of the developing brain to inhalational anesthetics can cause neurotoxicity. However, other studies have claimed that anesthetics can exert neuroprotective effects. We investigated the mechanisms associated with the neurotoxic and neuroprotective effects exerted by
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.