설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAGACCCTCATGCCATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAACGGGGAGGAAGGCATGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGCTTCACCAACGTGAACTTTGGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAGAAGCAAGATCCCCCAGTCACCCACGACCTTCGAGTCTCCCTTGAAGAGATCTACAGCGGCTGTACCAAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCCGACGGAAAGAGCATTCGAAACGAAGACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGAACCAAAATCACTTTCCCCAAGGAAGGAGACCAGACCTCCAACAACATTCCAGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... DNAJB1(3337) , DNAJB1(3337)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Sei-Kyoung Park et al.
PLoS genetics, 13(5), e1006805-e1006805 (2017-05-23)
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease characterized by selective loss of motor neurons with inclusions frequently containing the RNA/DNA binding protein TDP-43. Using a yeast model of ALS exhibiting TDP-43 dependent toxicity, we now show that TDP-43
Jyoti Batra et al.
Scientific reports, 6, 19063-19063 (2016-01-12)
A unique feature of influenza A virus (IAV) life cycle is replication of the viral genome in the host cell nucleus. The nuclear import of IAV genome is an indispensable step in establishing virus infection. IAV nucleoprotein (NP) is known
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.