콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU108431

Sigma-Aldrich

MISSION® esiRNA

targeting human GNAQ

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCACAATAAGGCTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCTTTAGAACAATTATCACATACCCCTGGTTCCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Grazia Ambrosini et al.
Molecular cancer therapeutics, 13(8), 2073-2080 (2014-06-06)
The majority of uveal melanomas carry oncogenic mutations in the G proteins GNAQ and GNA11, with consequent activation of the MAPK pathway. Selective MEK inhibitors, such as selumetinib, have shown clinical benefit in uveal melanoma. However, mechanisms of drug resistance
Eva Königshausen et al.
Scientific reports, 6, 39513-39513 (2016-12-23)
Glomerular permeability and subsequent albuminuria are early clinical markers for glomerular injury in hypertensive nephropathy. Albuminuria predicts mortality and cardiovascular morbidity. AT1 receptor blockers protect from albuminuria, cardiovascular morbidity and mortality. A blood pressure independent, molecular mechanism for angiotensin II
Honglei Liu et al.
Oncology reports, 34(1), 295-301 (2015-05-09)
The occurrence of guanine nucleotide binding protein (G protein), q polypeptide (GNAQ) mutations has been found to be high in the majority of uveal melanomas. However, the underlying molecular mechanism of GNAQ mutations in modulating uveal melanoma is poorly understood.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.