설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCACAATAAGGCTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCTTTAGAACAATTATCACATACCCCTGGTTCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GNAQ(2776) , GNAQ(2776)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Grazia Ambrosini et al.
Molecular cancer therapeutics, 13(8), 2073-2080 (2014-06-06)
The majority of uveal melanomas carry oncogenic mutations in the G proteins GNAQ and GNA11, with consequent activation of the MAPK pathway. Selective MEK inhibitors, such as selumetinib, have shown clinical benefit in uveal melanoma. However, mechanisms of drug resistance
Eva Königshausen et al.
Scientific reports, 6, 39513-39513 (2016-12-23)
Glomerular permeability and subsequent albuminuria are early clinical markers for glomerular injury in hypertensive nephropathy. Albuminuria predicts mortality and cardiovascular morbidity. AT1 receptor blockers protect from albuminuria, cardiovascular morbidity and mortality. A blood pressure independent, molecular mechanism for angiotensin II
Honglei Liu et al.
Oncology reports, 34(1), 295-301 (2015-05-09)
The occurrence of guanine nucleotide binding protein (G protein), q polypeptide (GNAQ) mutations has been found to be high in the majority of uveal melanomas. However, the underlying molecular mechanism of GNAQ mutations in modulating uveal melanoma is poorly understood.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.