설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGGAGGAGGTGCTCAAGATGTCCACGGAGGAGATCATCCAGCGCACACGGCTGCTGGACAGTGAGATCAAGATCATGAAGAGTGAAGTGTTGAGAGTCACCCATGAGCTCCAAGCCATGAAGGACAAGATAAAAGAGAACAGTGAGAAAATCAAAGTGAACAAGACCCTGCCGTACCTTGTCTCCAACGTCATCGAGCTCCTGGATGTTGATCCTAATGACCAAGAGGAGGATGGTGCCAATATTGACCTGGACTCCCAGAGGAAGGGCAAGTGTGCTGTGATCAAAACCTCTACACGACAGACGTACTTCCTTCCTGTGATTGGGTTGGTGGATGCTGAAAAGCTAAAGCCAGGAGACCTGGTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PSMC3(5702) , PSMC3(5702)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
J-S Dong et al.
European review for medical and pharmacological sciences, 24(5), 2264-2270 (2020-03-21)
The importance of circular RNAs in malignant tumors has attracted a lot of attention. Circular PSMC3 (CircPSMC3) is identified as a tumor suppressor in gastric cancer. The role of circPSMC3 in prostate cancer (PCa) remains unclear. Our study aims to
Maria Anania et al.
Oncotarget, 6(33), 34629-34648 (2015-10-03)
The incidence of thyroid carcinoma is rapidly increasing. Although generally associated with good prognosis, a fraction of thyroid tumors are not cured by standard therapy and progress to aggressive forms for which no effective treatments are currently available. In order
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.