콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU105721

Sigma-Aldrich

MISSION® esiRNA

targeting human PCNA

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAATGAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCGGATATGGGACA

Ensembl | 인체 수납 번호

ENSG00000132646

NCBI 수납 번호

NM_002592

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PCNA(5111) , PCNA(5111)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Amy Kwan et al.
Molecular cancer therapeutics, 20(3), 589-601 (2020-12-11)
Oncolytic viruses (OV) have been shown to activate the antitumor functions of specific immune cells like T cells. Here, we show OV can also reprogram tumor-associated macrophage (TAM) to a less immunosuppressive phenotype. Syngeneic, immunocompetent mouse models of primary breast
Keiichiro Sakuma et al.
Cancer science, 109(8), 2458-2468 (2018-06-06)
Heterogeneous nuclear ribonucleoprotein L-like (HNRNPLL), an RNA-binding protein that regulates alternative splicing of pre-mRNA, has been shown to regulate differentiation of lymphocytes, as well as metastasis of colorectal cancer cells. Here, we show that HNRNPLL promotes cell cycle progression and
N Kanu et al.
Oncogene, 35(30), 4009-4019 (2015-11-10)
The DNA replication machinery invariably encounters obstacles that slow replication fork progression, and threaten to prevent complete replication and faithful segregation of sister chromatids. The resulting replication stress activates ATR, the major kinase involved in resolving impaired DNA replication. In
Joachim Garbrecht et al.
Nucleus (Austin, Tex.), 9(1), 474-491 (2018-09-13)
Fluorescence microscopy in combination with the induction of localized DNA damage using focused light beams has played a major role in the study of protein recruitment kinetics to DNA damage sites in recent years. Currently published methods are dedicated to
Wanwan Jia et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 4031-4042 (2018-02-27)
Rheumatoid arthritis (RA) is an immune-mediated disease with the characteristics of progressive joint destruction, deformity, and disability. Epigenetic changes have been implicated in the development of some autoimmune disorders, resulting in an alteration of gene transcription. Here, we investigated how
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.