설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAGGAGGTGAGTGCTCTGGAGTGCGAGATCCAGTTGCTAAAGAACTTGCAGCATGAGCGCATCGTGCAGTACTATGGCTGTCTGCGGGACCGCGCTGAGAAGACCCTGACCATCTTCATGGAGTACATGCCAGGGGGCTCGGTGAAAGACCAGTTGAAGGCTTACGGTGCTCTGACAGAGAGCGTGACCCGAAAGTACACGCGGCAGATCCTGGAGGGCATGTCCTACCTGCACAGCAACATGATTGTTCACCGGGACAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MAP3K3(4215) , MAP3K3(4215)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
FEBS letters, 591(15), 2290-2298 (2017-06-24)
Lineage-negative bone marrow cells (lin-BMCs) have reparative potential for overcoming endothelial dysfunction and reducing cardiovascular risk. Here, we found that miR-188 is upregulated and mitogen-activated protein kinase kinase kinase 3 (MAP3K3) is downregulated in aged lin-BMCs, whereas their expression is reversed
Journal of neuroinflammation, 15(1), 13-13 (2018-01-14)
Parkinson's disease (PD) is the most prevalent neurodegenerative disorder that is characterised by selective loss of midbrain dopaminergic (DA) neurons. Chronic inflammation of the central nervous system is mediated by microglial cells and plays a critical role in the pathological
Science signaling, 7(349), ra102-ra102 (2014-10-30)
Anaplastic lymphoma kinase (ALK) is an important molecular target in neuroblastoma. Although tyrosine kinase inhibitors abrogating ALK activity are currently in clinical use for the treatment of ALK-positive (ALK(+)) disease, monotherapy with ALK tyrosine kinase inhibitors may not be an
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.