설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTCACATCCGTACCCAACTTGTTTACCTATAGCTCTTTCAACAATGGGCAGTTAGCACCAGGGATAACCATGACTGAAATCGACCGAATTGCACAGAACATCATTAAGTCCCATTTGGAGACATGTCAATACACCATGGAAGAGCTGCACCAGCTGGCGTGGCAGACCCACACCTATGAAGAAATTAAAGCATATCAAAGCAAGTCCAGGGAAGCACTGTGGCAACAATGTGCCATCCAGATCAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RORB(6096) , RORB(6096)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Peter O Oladimeji et al.
Biochemical pharmacology, 160, 92-109 (2018-12-20)
The pregnane X receptor (PXR) is a principal xenobiotic receptor crucial in the detection, detoxification, and clearance of toxic substances from the body. PXR plays a vital role in the metabolism and disposition of drugs, and elevated PXR levels contribute to cancer
Joerg Betschinger et al.
Cell, 153(2), 335-347 (2013-04-16)
Factors that sustain self-renewal of mouse embryonic stem cells (ESCs) are well described. In contrast, the machinery regulating exit from pluripotency is ill defined. In a large-scale small interfering RNA (siRNA) screen, we found that knockdown of the tumor suppressors
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.