설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GATGATGGCACGAACATGACCTATGGAACCTCTCCTTCTGGTCTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTGCTCCAGGACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCATTCCGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGGCTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGGGGCCAGGTGGAGTGGAACGGTTCTTGGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CAPN3(825) , CAPN3(825)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Ivone de Andrade Rosa et al.
Tissue & cell, 67, 101436-101436 (2020-09-16)
CAPN3 is a muscle-specific and an intrinsically disordered protein. Thus, as a scaffolding protein CAPN3 could play a role during early stages of myogenesis. To test this hypothesis, we studied the distribution and function of CAPN3 during myogenesis using embryonic
Ting Tao et al.
Cell research, 23(5), 620-634 (2013-01-30)
p53 protein turnover through the ubiquitination pathway is a vital mechanism in the regulation of its transcriptional activity; however, little is known about p53 turnover through proteasome-independent pathway(s). The digestive organ expansion factor (Def) protein is essential for the development
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.