설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
ACGATGCATGCCATATACGAAAGGAAAAAGGGCAGGGGGTTCCCCCAAACTTTCGAAGTAGGCCCTGGCAGGCAGCTGGGAGCCATCCTGAAGAGCTGTAACATGCAGGCCTGGAAGTCCTACAGCGCCGTGGATGTGCTGCAGACCCTCGAACATGTGGACCTGGACCCTCAGGAGCCCCCGAGATGACTGCAGGGGGCTCAAATGCGATGACCCCCTCTGTCCTCCTGAGGAGAGGCTGTAGGCTGTGCCTGTCGCCCCCTACCTTCCTAATGGCTCCTCCTCTGAGGAGTGAAAGGGATTTGTTTGCAACG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MCAT(27349) , MCAT(27349)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
The adaptor protein ARA55 and the nuclear kinase HIPK1 assist c-Myb in recruiting p300 to chromatin.
Mads Bengtsen et al.
Biochimica et biophysica acta, 1860(7), 751-760 (2017-05-13)
LIM-domain proteins, containing multiple cysteine-rich zinc finger-like motifs, have been shown to play diverse roles in several cellular processes. A common theme is that they mediate important protein-protein interactions that are key to their function. Androgen receptor-associated protein 55 (ARA55)
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.