설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAGTTAGGAGAACATGGAAAGGAAATTTTATTATCAAATAGTGATCCCCATGATATACCAGAATCAAAGGACTGTGTGCTGACTATTTCAGAAGAAATGTTCTCCAAAGATAAAACATTTATAGTTAGACAGTCTATTCATGATGAGATTTCAGTGTCAAGCATGGATGCTTCTAGACAACTAATGTTGAATGAAGAACAGTTGGAAGATATGAGACAGGAACTTGTACGACAATACCAAGAACATCAACAGGCAACGGAATTGTTAAGGCAAGCACATATGCGGCAAATGGAGAGACAGCGAGAAGACCAGGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... AKAP9(10142) , AKAP9(10142)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Haoxiao Zuo et al.
Cells, 9(2) (2020-02-08)
Epithelial-to-mesenchymal transition (EMT) plays a role in chronic obstructive pulmonary diseases (COPD). Cyclic adenosine monophosphate (cAMP) can inhibit transforming growth factor-β1 (TGF-β1) mediated EMT. Although compartmentalization via A-kinase anchoring proteins (AKAPs) is central to cAMP signaling, functional studies regarding their
Shoji Hata et al.
Nature cell biology, 21(9), 1138-1151 (2019-09-05)
One of the first steps in mitotic spindle assembly is the dissolution of the centrosome linker followed by centrosome separation driven by EG5, a tetrameric plus-end-directed member of the kinesin-5 family. However, even in the absence of the centrosome linker
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.