설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GCCCAAAGAAACTGTGGTGTCTCGTTGGCGTGCTGATCCCTGGGCTCGGGGCTCTTATTCCTATGTTGCTGCAGGATCATCTGGAAATGACTATGATTTAATGGCTCAGCCAATCACTCCTGGCCCCTCGATTCCAGGTGCCCCACAGCCGATTCCACGACTCTTCTTTGCGGGAGAACATACGATCCGTAACTACCCAGCCACAGTGCATGGTGCTCTGCTGAGTGGGCTGCGAGAAGCGGGAAGAATTGCAGACCAGTTTTTGGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... KDM1A(23028) , AOF2(23028)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Ghanshyam Upadhyay et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(22), 8071-8076 (2014-05-21)
Lysine-specific demethylase 1 (LSD1) demethylates nucleosomal histone H3 lysine 4 (H3K4) residues in collaboration with the corepressor CoREST/REST corepressor 1 (Rcor1) and regulates cell fates by epigenetically repressing gene targets. The balanced regulation of this demethylase, if any, is however
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.