설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
AGAAAATGAAGGACCTCAAAGCACCTGAACAGTTTATCGACCAGTTTGAATCTATTTATCTTCATTTGAATGTCTTCTAGAATATGTAAAAAGTCATAAAATGTATCTTCCATGCTACATGTACAATAAGAACTTCTATAATTGTATATATGCCTTTGATGTATTTTCCCCTCAAGATTATCAACTGTGTGTTCGACAGTGAATATTCAATCTGGTACCAGTTGAAATTTTTGGTTATAAATGTAATACGAATTGTTTCACAAACAGAAAACATGTAAAGCAGTATTAAAATTTGGCCAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CLIP1(6249) , CLIP1(6249)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Cell cycle (Georgetown, Tex.), 14(9), 1379-1388 (2015-05-01)
Dynein light chains are accessory subunits of the cytoplasmic dynein complex, a minus-end directed microtubule motor. Here, we demonstrate that the dynein light chain Tctex-1 associates with unattached kinetochores and is essential for accurate chromosome segregation. Tctex-1 knockdown in cells
Cell reports, 30(1), 269-283 (2020-01-09)
End-binding proteins (EBs) are widely viewed as master regulators of microtubule dynamics and function. Here, we show that while EB1 mediates the dynamic microtubule capture of herpes simplex virus type 1 (HSV-1) in fibroblasts, in neuronal cells, infection occurs independently
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.