설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GACAGATTCGCAGCACAGAGTCGCTGGCATGTTTCACTCCTGCTTCTCTCAGCCAGCTGTTTAAGCCTGCGGCGCCAGCCTCACGGAGGGCCGTGTGACACTCTCGTGGTATGTATGGGAGATGGCAGCAGTGAAGCAGCAGCCACCAGGGAGTGGCCATTTGGGGTTGGGACAGGGAGGGTGTTTTGGGTGGCATAGAGGTTTTGTATTGAGGGCCAGTGATGATGTTTTGATATTTATTTCCTGCTACTTAAATTTGAATCTGAGTGAATTGTACCTATTTCTGATGATGTCGGTCTTGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Tsz-Lun Yeung et al.
Oncotarget, 8(10), 16951-16963 (2017-02-16)
Transcription factors are master switches for various biochemical pathways. However, transcription factors involved in the pathogenesis of ovarian cancer have yet to be explored thoroughly. Therefore, in the present study, we assessed the prognostic value of the transcription factor E74-like
Olivier Godfroy et al.
The Plant cell, 29(12), 3102-3122 (2017-12-07)
Brown algae are one of the most developmentally complex groups within the eukaryotes. As in many land plants and animals, their main body axis is established early in development, when the initial cell gives rise to two daughter cells that
Mi-Ok Lee et al.
Biochemical and biophysical research communications, 520(2), 406-412 (2019-10-15)
Selenium (Se) plays a vital role in reactive oxygen species (ROS) homeostasis and redox regulation in intracellular signaling via selenocysteine (Sec), known as the 21st proteinogenic amino acid, but its specific biological functions in development and disease remain undiscovered. In
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM
Farah Sharieh et al.
Alcoholism, clinical and experimental research, 44(6), 1204-1213 (2020-04-19)
During bone fracture repair, resident mesenchymal stem cells (MSCs) differentiate into chondrocytes, to form a cartilaginous fracture callus, and osteoblasts, to ossify the collagen matrix. Our laboratory previously reported that alcohol administration led to decreased cartilage formation within the fracture
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.