설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGAAGCAACACTGCCAGAAGTGTGTTTTGGTATGCACTGGTTCCTTAAGTGGCTGTGATTAATTATTGAAAGTGGGGTGTTGAAGACCCCAACTACTATTGTAGAGTGGTCTATTTCTCCCTTCAATCCTGTCAATGTTTGCTTTACGTATTTTGGGGAACTGTTGTTTGATGTGTATGTGTTTATAATTGTTATACATTTTTAATTGAGCCTTTTATTAACATATATTGTTATTTTTGTCTCGAAATAATTTTTTAGTTAAAATCTATTTTGTCTGATATTGGTGTGAATGCTGTACCTTTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SNCA(6622) , SNCA(6622)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Hyeong-Jin Baek et al.
Neuroscience letters, 600, 6-11 (2015-06-03)
Notch signaling pathway is well known that it is involved in regulating cell fate, proliferation and homeostasis. In this study, we show a novel function of alpha-synuclein (SNCA) to promote degradation of Notch1 intracellular domain (Notch1-IC) through Fbw7, ubiquitin E3
Yong-Xiao Li et al.
Cancer science, 109(4), 1263-1275 (2018-01-26)
Medulloblastoma (MB) is the most common malignant brain tumor in childhood. It contains at least four distinct molecular subgroups. The aim of this study is to explore novel diagnostic and potential therapeutic markers within each subgroup of MB, in particular
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.