추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGTTCAGGCCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAGACACAGTTCAATCAGTATAAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGTGATGTGCCATTTCCTTTCTCTGCCCAGTCTGGGGCTGGGGTGCCAGGCTGGGGCATCGCGCTGCTGGTGCTGGTCTGTGTTCTGGTTGCGCTGGCCATTGTCTATCTCATTGCCTTGGCTGTCTGTCAGTGCCGCCGAAAGAACTACGGGCAGCTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MUC1(4582) , MUC1(4582)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Satomi Shiba et al.
The Journal of surgical research, 238, 79-89 (2019-02-15)
Mucin1 (MUC1), a member of the mucin family, is a glycoprotein which is often expressed in malignant cells. However, the expression and function of MUC1 in human duodenal adenocarcinoma (DAC) has not yet been characterized because of its low frequency.
Ping Li et al.
International journal of clinical and experimental pathology, 8(9), 10365-10374 (2015-12-01)
Muc-1 is a member of the carbohydrate-binding protein family that contributes to neoplastic transformation, tumor survival, angiogenesis, and metastasis. The aim of this study is to investigate the role of muc-1 in human oral squamous cell carcinoma progression. In this
Dina Stroopinsky et al.
Journal of cellular and molecular medicine (2018-05-16)
Acute myeloid leukaemia (AML) is an aggressive haematological malignancy with an unmet need for improved therapies. Responses to standard cytotoxic therapy in AML are often transient because of the emergence of chemotherapy-resistant disease. The MUC1-C oncoprotein governs critical pathways of
Ashujit Tagde et al.
Oncotarget, 8(41), 69237-69249 (2017-10-21)
The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM
Yu-Ming Wang et al.
Drug design, development and therapy, 13, 3391-3404 (2019-10-03)
It has been reported that approximately 40% of ALI (acute lung injury) incidence resulted from sepsis. Paclitaxel, as a classic anti-cancer drug, plays an important role in the regulation of inflammation. However, we do not know whether it has a
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.