설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GACCATCACCCTCAGCAGTTCAGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGGATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTTAAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAACAGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAAGATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NRG1(3084) , NRG1(3084)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Youya Wang et al.
Journal of thoracic disease, 10(6), 3166-3179 (2018-08-03)
Neuregulin1 (NRG1) is critical signaling protein that mediates the activation of downstream signaling pathways associated with malignancies. Multiple gene fusions related to NRG1 have been found in lung cancer. However, the underlying role NRG1 in lung cancer is yet unclear.
K Yonesaka et al.
Oncogene, 35(7), 878-886 (2015-05-12)
Human epidermal growth factor receptor (HER) 3 is aberrantly overexpressed and correlates with poor prognosis in non-small cell lung cancer (NSCLC). Patritumab is a monoclonal antibody against HER3 that has shown promising results in early-phase clinical trials, but an optimal
Alessandra Bolino et al.
EMBO molecular medicine, 8(12), 1438-1454 (2016-11-02)
Charcot-Marie-Tooth (CMT) neuropathies are highly heterogeneous disorders caused by mutations in more than 70 genes, with no available treatment. Thus, it is difficult to envisage a single suitable treatment for all pathogenetic mechanisms. Axonal Neuregulin 1 (Nrg1) type III drives
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.