설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACGTCCATCGAGGACTTCAGCGAAGTGTACTTGGTGACCACCCTGATGGGCGCCGACCTGAACAACATCGTCAAGTGCCAGGCGCTGAGCGACGAGCACGTTCAATTCCTGGTTTACCAGCTGCTGCGCGGGCTGAAGTACATCCACTCGGCCGGGATCATCCACCGGGACCTGAAGCCCAGCAACGTGGCTGTGAACGAGGACTGTGAGCTCAGGATCCTGGATTTTGGGCTGGCGCGCCAGGCGGACGAGGAGATGACCGGCTATGTGGCCACGCGCTGGTACCGGGCACCTGAGATCATGCTCAACTGGATGCATTACAACCAAACAGTGGATATCTGGTCCGTGGGCTGCATCATGGCTGAGCTGCTCCAGGGCAAGGCCCTCTTCCCGGGAAGCGACTACATTGACCAGCTGAAGCG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MAPK11(5600) , MAPK11(5600)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Xiaoyu Zhang et al.
Antiviral research, 167, 68-77 (2019-04-07)
Lassa virus (LASV) causes Lassa hemorrhagic fever in humans and poses a significant threat to public health in West Africa. Current therapeutic treatments for Lassa fever are limited, making the development of novel countermeasures an urgent priority. In this study
A J Browne et al.
Cell death & disease, 7, e2119-e2119 (2016-02-26)
The Wnt inhibitor Dickkopf-1 (DKK-1) has been associated with the occurrence of bone metastases in osteotropic prostate cancer by inhibiting osteoblastogenesis. P38 mitogen-activated protein kinase (MAPK) activity is also dysregulated in advanced prostate cancer. However, the impact of p38 MAPK
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.