콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU093851

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GATGACTTGTGGGTGCTCCTGGCTCAACCCAACCAACAGGACTGACTGACTGGCAGGACAAGGTCTGGCATGGCACAGCACCACTGCCAGGCCTCCCCAGGCACACCACTCTGCCCAGGGAATGGGGGCTTTGGGTCATCTCCCACTGCCTGGGGGAGTCAGATGGGGTGCAGGAATCTGGCTCTTCAGCCATCTCAGGTTTAGGGGGTTTGTAACAGACATTATTCTGTTTTCACTGCGTATCCTTGGTAAGCCCTGTGGACTGGTTCCTGCTGTGTGATGCTGAGGGTTTTAAGGTGGGGAGAGATAAGGGCTCTCTCGGGCCATGCTACCCGGTATGACTGGGTAATGAGGACAGACTGTGGACACCCCATCTACCTGAGTCTGATTCTTTAGCAGCAGAGACTGAGGGGTGCAGAGTGT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zi Wang et al.
Journal of molecular medicine (Berlin, Germany), 98(12), 1781-1794 (2020-11-01)
Autotaxin (ATX) is a secreted enzyme that hydrolyzes lysophosphatidylcholine (LPC) to lysophosphatidic acid (LPA) and choline. ATX has been implicated in multiple chronic inflammatory diseases, but little is known about its role in the development of inflammatory bowel disease (IBD).
Ying Zhang et al.
OncoTargets and therapy, 13, 4145-4155 (2020-06-12)
The dysregulation of the human papillomavirus 18 E6 and E7 oncogenes plays a critical role in the angiogenesis of cervical cancer (CC), including the proliferation, migration, and tube formation of vascular endothelial cells. Interfering E6/E7 increases the number of CC
Simon McArthur et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 1139-1151 (2015-06-24)
Blood-derived monocytes remove apoptotic cells and terminate inflammation in settings as diverse as atherosclerosis and Alzheimer's disease. They express high levels of the proresolving receptor ALX/FPR2, which is activated by the protein annexin A1 (ANXA1), found in high abundance in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.