콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU093651

Sigma-Aldrich

MISSION® esiRNA

targeting human SUV39H2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGAGCTGTGACTTGCAGAGGTTACCTCAACTGAACTTTTTCAGGAAATAGAGCTGATGATTATAATATTTTTTTCCTAATGTTAACATTTTTAAAAATACATATTTGGGACTCTTATTATCAAGGTTCTACCTATGTTAATTTACAATTCATGTTTCAAGACATTTGCCAAATGTATTACCGATGCCTCTGAAAAGGGGGTCACTGGGTCTCATAGACTGATATGAAGTCGACATATTTATAGTGCTTAGAGACCAAACTAATGGAAGGCAGACTATTTACAGCTTAGTATATGTGTACTTAAGTCTATGTGAACAGAGAAATGCCTCCCGTAGTGTTTGAAAGCGTTAAGCTGATAATGTAATTAACAACTGCTGAGAGATCAAAGATTCAACTTGCCATACACCTCAAATTCGGAGAAACA

Ensembl | 인체 수납 번호

ENSG00000152455

NCBI 수납 번호

NM_024670

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SUV39H2(79723) , SUV39H2(79723)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yue Zhang et al.
Journal of molecular cell biology, 11(9), 761-769 (2018-12-12)
X chromosome inactivation and genomic imprinting are two classic epigenetic regulatory processes that cause mono-allelic gene expression. In female mammals, mono-allelic expression of the long non-coding RNA gene X-inactive specific transcript (XIST) is essential for initiation of X chromosome inactivation
Wendi Shuai et al.
Cancer letters, 422, 56-69 (2018-02-20)
Suppressor of variegation 3-9 homolog 2 (SUV39H2) is a member of the SUV39H subfamily of lysine methyltransferases. Its role in colorectal cancer (CRC) proliferation and metastasis has remained unexplored. Here, we determined that SUV39H2 was upregulated in CRC tissues compared
Emily B Askew et al.
Molecular and cellular endocrinology, 443, 42-51 (2017-01-04)
Androgen receptor (AR) transcriptional activity depends on interactions between the AR NH
Oriane Mauger et al.
Nucleic acids research, 43(3), 1869-1882 (2015-01-22)
Alternative splicing is the main source of proteome diversity. Here, we have investigated how alternative splicing affects the function of two human histone methyltransferases (HMTase): G9A and SUV39H2. We show that exon 10 in G9A and exon 3 in SUV39H2

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.