설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGTACAAGGGTATGGTAATGCTTGTAGAATCTTTATTATCTCAACAATCTAAAAAATGATGTTTATTTCCATAGTTTGATAGTGCCACTTAAATGCCAATTAAACAAGAATATAACATTTCAATAGAAATTTTTATTTCATTTTCAATTACTTTGTAAATTCGTGTGTATTTAGTACACTGATTTGTTTTTTTACATTTCTGCTTTGAATGCAGATGCAATTTAATATAATAGATTTTTTAATGAATTAATCTTAACATAGTAATCTTTAGCTTTTTATACAAATATATTTAATTTAGGAGTATATGTGTGTCTATACACACACATACATAAATATACCACATATACACCTGATAGTCAAATAAGGTACAGAAATTTTATCTTGTCAATTATGCCAAATAATCTCTTTAATGTGCACTCAAACA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Adenosine kinase facilitated astrogliosis-induced cortical neuronal death in traumatic brain injury.
Wei Jin et al.
Journal of molecular histology, 47(3), 259-271 (2016-03-18)
Adenosine kinase (ADK) plays a pivotal role in regulating brain function by regulating adenosine level, and ADK inhibition protects against neuronal damage in cerebral ischemia and epilepsy; however, the effects of ADK in traumatic brain injury (TBI) have not been
Iwona Pelikant-Malecka et al.
The international journal of biochemistry & cell biology, 88, 31-43 (2017-03-23)
4-pirydone-3-carboxamide-1β-d-ribonucleoside (4PYR) is an endogenous nucleoside that could be converted to triphosphates, diphosphates, monophosphates and an analogue of NAD - 4PYRAD. Elevated level of these compounds have been reported in chronic renal failure, cancer and active HIV infection. However, little
Alexander J Valvezan et al.
JCI insight, 5(7) (2020-04-10)
Recent studies in distinct preclinical tumor models have established the nucleotide synthesis enzyme inosine-5'-monophosphate dehydrogenase (IMPDH) as a viable target for antitumor therapy. IMPDH inhibitors have been used clinically for decades as safe and effective immunosuppressants. However, the potential to
Tal Israeli et al.
Journal of cell science, 131(15) (2018-07-14)
AMPK-mTORC1 signaling senses nutrient availability, thereby regulating autophagy. Surprisingly, we found that, in β-cells, the AMPK activator 5-amino-4-imidazolecarboxamide ribofuranoside (AICAR) inhibited, rather than stimulated, autophagy. AICAR is an intermediate in the generation of inosine monophosphate, with subsequent conversion to other
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.