설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGAGTGCAGAATTGCCTGATGCTGTGGGACCTATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACCCAGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCAGAAACCGGATGTAAAATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAATAGAGGCAAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAGCAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTACCTGCAGCAGAAGGAGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTGAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yunling Wang et al.
PloS one, 5(9) (2010-09-24)
The quaking viable (qk(v)) mouse has several developmental defects that result in rapid tremors in the hind limbs. The qkI gene expresses three major alternatively spliced mRNAs (5, 6 and 7 kb) that encode the QKI-5, QKI-6 and QKI-7 RNA
Feng-Yang Zong et al.
PLoS genetics, 10(4), e1004289-e1004289 (2014-04-12)
Lung cancer is the leading cause of cancer-related death worldwide. Aberrant splicing has been implicated in lung tumorigenesis. However, the functional links between splicing regulation and lung cancer are not well understood. Here we identify the RNA-binding protein QKI as
Salma H Azam et al.
Oncogene, 38(26), 5191-5210 (2019-03-29)
Angiogenesis is critical to cancer development and metastasis. However, anti-angiogenic agents have only had modest therapeutic success, partly due to an incomplete understanding of tumor endothelial cell (EC) biology. We previously reported that the microRNA (miR)-200 family inhibits metastasis through
Yan Sun et al.
Cell death & disease, 11(6), 432-432 (2020-06-10)
Vascular remodeling can be caused by angiotensin II type 1 receptor (AT1R) autoantibody (AT1-AA), although the related mechanism remains unknown. Angiotensin II type 2 receptor (AT2R) plays multiple roles in vascular remodeling through cross-talk with AT1R in the cytoplasm. Here
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.