콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU090641

Sigma-Aldrich

MISSION® esiRNA

targeting human RASAL2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGACTGGTCGCCAATTTGTAGAAAAGTGGTATCCAGTGAGTACACCTACACCCAACAAAGGAAAGACAGGAGGACCTTCTATTCGGATTAAATCACGTTTCCAAACTATCACCATTCTGCCTATGGAGCAATACAAAGAATTTGCAGAATTTGTCACCAGCAACTACACCATGCTGTGTTCTGTCCTTGAGCCAGTAATTAGTGTGAGAAATAAAGAGGAGTTGGCTTGTGCCTTAGTGCACATTCTTCAAAGTACTGGCAGAGCCAAGGATTTTCTGACTGACTTGGTGATGTCTGAGGTGGATCGTTGTGGAGAGCATGATGTCTTGATCTTCAGAGAGAACACTATTGCCACCAAATCCATTGAGGAATACCTCAAGTTGGTGGGACAACAGTATCTTCATGACGCACTGGGGGAGTTTATCAA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ke Hui et al.
Cell death & disease, 8(2), e2600-e2600 (2017-02-10)
Muscle-invasive or metastatic bladder cancer (BCa) is associated with a very poor prognosis, and the underlying mechanism remains poorly understood. In this study, we demonstrate RASAL2, a RAS GTPase-activating protein (RAS GAP), acts as a tumor suppressor in BCa. First
Libo Yin et al.
Molecular therapy oncolytics, 14, 74-81 (2019-05-03)
Pancreatic ductal adenocarcinoma (PDA) is one of the most lethal tumors, with poor therapeutic options in the advanced state. The broccoli-derived anti-inflammatory agent sulforaphane was shown to inhibit the progression of pancreatic cancer and other tumor entities. We examined the
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.