콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU090071

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC9 (3)

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGTTCTCCAGGCTCTGGTCCCAGTTCACCAAACAATGGGCCAACTGGAAGTGTTACTGAAAATGAGACTTCGGTTTTGCCCCCTACCCCTCATGCCGAGCAAATGGTTTCACAGCAACGCATTCTAATTCATGAAGATTCCATGAACCTGCTAAGTCTTTATACCTCTCCTTCTTTGCCCAACATTACCTTGGGGCTTCCCGCAGTGCCATCCCAGCTCAATGCTTCGAATTCACTCAAAGAAAAGCAGAAGTGTGAGACGCAGACGCTTAGGCAAGGTGTTCCTCTGCCTGGGCAGTATGGAGGCAGCATCCCGGCATCTTCCAGCCACCCTCATGTTACTTTAGAGGGAAAGCCACCCAACAGCAGCCACCAGGCTCTCCTGCAGCATTTATTATTGAAAGAACAAATGCGACAGCAAAAGCTT

Ensembl | 인체 수납 번호

ENSG00000048052

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... HDAC9(9734) , HDAC9(9734)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
BZS
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhiqiang Yu et al.
Oncology letters, 17(3), 3296-3304 (2019-03-15)
Gastric cancer (GC) is a common life-threatening cancer type worldwide, with an increasing prevalence and a high rate of mortality. Due to limitations in clinical treatment, surgery has become the most efficient strategy for the treatment of GC. It is
Yue Yang et al.
The Journal of nutritional biochemistry, 40, 172-177 (2016-12-05)
Activation of hepatic stellate cells (HSCs) is critical for liver fibrosis development. Previously, we showed that astaxanthin (ASTX), a xanthophyll carotenoid, has antifibrogenic effects in LX-2 cells, a human HSC cell line. We sought to determine the effect of ASTX
Gaoyan Wang et al.
Molecular carcinogenesis, 59(12), 1392-1408 (2020-10-21)
Countless evidence suggests that long noncoding RNAs (lncRNAs) are involved in human malignant cancers, including esophageal squamous cell carcinoma (ESCC), although their exact function remains unclear. In the present study, we aimed to investigate the roles and molecular mechanisms of the
Changliang Shan et al.
Cell death & disease, 10(7), 525-525 (2019-07-10)
4-hydroxyphenylpyruvate dioxygenase (HPD) is an important modifier of tyrosine metabolism. However, the precise contribution of HPD to cancer metabolism and tumorigenesis remains unclear. In this study, we found that HPD was highly expressed in lung cancer and its higher expression
Dong-Qin Chen et al.
Therapeutic advances in medical oncology, 10, 1758835918783132-1758835918783132 (2018-07-24)
Treatment of metastatic castration-resistant prostate cancer (mCRPC) with docetaxel often fails due to the emergence of chemoresistance. Thus, restoring chemosensitivity to docetaxel-based therapies remains a challenge in mCRPC treatment. microRNA (miR)-451 expression was measured in docetaxel-treated prostate cancer cells and
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.