설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAGGTCACCACCAACCAGACCAGTCCCTGGTCATAGGTCTGAAAGGGCAATCCGGACCCAGCCCAAGCAACTGATTGTGGATGACTTGAAGGGTTCCTTGAAAGAGGACCTGACACAGCACAAGTTCATTTGTGAACAGTGTGGGAAGTGCAAGTGTGGAGAATGCACTGCTCCCAGGACCCTACCATCCTGTTTGGCCTGTAACCGGCAGTGCCTTTGCTCTGCTGAGAGCATGGTGGAATATGGAACCTGCATGTGCTTAGTCAAGGGCATCTTCTACCACTGCTCCAATGACGACGAAGGGGATTCCTATTCAGATAATCCTTGCTCCTGTTCACAATCACACTGCTGCTCTAGATACCTGTGTATGGGAGCCATGTCTTTATTTTTACCTTGCTTACTCTGTTATCCTCCTGCTAAAGGATGCCTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SPRY1(10252) , SPRY1(10252)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Z-S Yuan et al.
European review for medical and pharmacological sciences, 21(22), 5072-5080 (2017-12-12)
Gliomas are accompanied with high mortality owning to their invasive peculiarity and vulnerability to drug resistance. miR-21 is a vital oncogenic miRNA that regulates drug resistance of tumor cells. This study aims to elucidate the function of miR-21 in human
Juliana F Germano et al.
Virology, 529, 169-176 (2019-02-04)
Coxsackievirus B is a significant human pathogen and is a leading cause of myocarditis. We and others have observed that certain enteroviruses including coxsackievirus B cause infected cells to shed extracellular vesicles containing infectious virus. Recent reports have shown that
Naoki Terada et al.
Journal of cellular biochemistry, 115(9), 1505-1515 (2014-03-08)
Prostate cancer is a heterogeneous disease and thus, it is important to understand whether among the heterogeneous collection of cell types, androgen-deprivation insensitive cells exist prior to hormonal manipulation. We established several LNCaP subclones with distinct insensitivities to androgen deprivation
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.