설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACATTGCTGCCATCACTGAATCAGACAAGTTCTTCATCAACGGCTCCAACTGGGAAGGCATCCTGGGGCTGGCCTATGCTGAGATTGCCAGGCCTGACGACTCCCTGGAGCCTTTCTTTGACTCTCTGGTAAAGCAGACCCACGTTCCCAACCTCTTCTCCCTGCAGCTTTGTGGTGCTGGCTTCCCCCTCAACCAGTCTGAAGTGCTGGCCTCTGTCGGAGGGAGCATGATCATTGGAGGTATCGACCACTCGCTGTACACAGGCAGTCTCTGGTATACACCCATCCGGCGGGAGTGGTATTATGAGGTGATCATTGTGCGGGTGGAGATCAATGGACAGGATCTGAAAATGGACTGCAAGGAGTACAACTATGACAAGAGCATTGTGGACAGTGGCACCACCAACCTTCGTTTGCCCAAGAAAGTGTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... BACE1(23621) , BACE1(23621)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Chi Zhang et al.
Current pharmaceutical biotechnology, 20(1), 56-62 (2019-02-08)
To deliver drugs to treat Alzheimer's Disease (AD), nanoparticles should firstly penetrate through blood brain barrier, and then target neurons. Recently, we developed an Apo A-I and NL4 dual modified nanoparticle (ANNP) to deliver beta-amyloid converting enzyme 1 (BACE1) siRNA.
Nan Zhang et al.
Neuroreport, 31(3), 205-212 (2019-12-27)
Alzheimer's disease is the most common neurodegenerative disease, characterized by accumulation of amyloid β peptides. MicroRNAs have been identified as significant regulators and therapeutic targets of Alzheimer's disease. However, the roles of miR-16-5p and miR-19b-3p and their mechanisms in Alzheimer's
Xiaoyao Zheng et al.
Acta biomaterialia, 49, 388-401 (2016-11-16)
To realize the therapeutic potential of gene drugs for Alzheimer's disease (AD), non-invasive, tissue-specific and efficient delivery technologies must be developed. Here, a hybrid system for amyloid plaques targeted siRNA delivery was formed by PEGylated Poly(2-(N,N-dimethylamino) ethyl methacrylate) (PEG-PDMAEMA) conjugated
Pengzhen Wang et al.
Journal of controlled release : official journal of the Controlled Release Society, 279, 220-233 (2018-04-22)
β-site amyloid precursor protein cleaving enzyme 1 (BACE1) is a key enzyme to cleave the amyloid precursor protein to develop Alzheimer's disease (AD). Reducing BACE1 expression in central neuron through RNA interference technology shows great promise to overcome AD. However
Sujoy Bera et al.
EMBO reports, 21(6), e47954-e47954 (2020-04-24)
Cleavage of amyloid precursor protein (APP) by BACE-1 (β-site APP cleaving enzyme 1) is the rate-limiting step in amyloid-β (Aβ) production and a neuropathological hallmark of Alzheimer's disease (AD). Despite decades of research, mechanisms of amyloidogenic APP processing remain highly
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.