콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU087041

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2L1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGTTTGTGGCCTCAGAATTGATCATTTTCCCCCCACTCTCCCCACACTAACCTGGGTTCCCTTTCCTTCCATCCCTACCCCCTAAGAGCCATTTAGGGGCCACTTTTGACTAGGGATTCAGGCTGCTTGGGATAAAGATGCAAGGACCAGGACTCCCTCCTCACCTCTGGACTGGCTAGAGTCCTCACTCCCAGTCCAAATGTCCTCCAGAAGCCTCTGGCTAGAGGCCAGCCCCACCCAGGAGGGAGGGGGCTATAGCTACAGGAAGCACCCCATGCCAAAGCTAGGGTGGCCCTTGCAGTTCAGCACCACCCTAGTCCCTTCCCCTCCCTGGCTCCCATGACCATACTGAGGGACCAACTGGGCCCAAGACAGATGCCCCAGAGCTGTTTATGGCCTCAGCTGCCTCACTTCCTACAAGAGCAGCCTGTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jihong Shi et al.
Laboratory investigation; a journal of technical methods and pathology, 98(11), 1423-1437 (2018-08-10)
Hypertrophic scarring is a serious fibrotic skin disease, and the abnormal activation of hypertrophic scar fibroblasts (HSFs) intensifies its pathogenesis. Our previous studies have demonstrated that the dysregulation of autophagy in HSFs is associated with fibrosis. However, knowledge regarding the
Yun Jung Choi et al.
Scientific reports, 9(1), 7193-7193 (2019-05-12)
Mantle cell lymphoma (MCL) is typically an aggressive and rare form of non-Hodgkin lymphoma (NHL) with a poor prognosis despite recent advances in immunochemotherapy and targeted therapeutics against NHL. New therapeutic agents are needed for MCL. In this study, we
Sahar Taghavi et al.
International journal of pharmaceutics, 516(1-2), 301-312 (2016-11-15)
In this project, synergistic cancer cell death was achieved by a targeted delivery system comprising Bcl-xL-specific shRNA and a very low DOX content, which simultaneously activated an intrinsic apoptotic pathway. A modified branched polyethylenimine (PEI 10kDa) was grafted through polyethylene
Sachie Hirai et al.
Biochemical and biophysical research communications, 526(2), 417-423 (2020-04-01)
Although most EGFR-mutant lung adenocarcinomas initially respond to EGFR inhibitors, disease progression almost inevitably occurs. We previously reported that two EGFR-mutant lung adenocarcinoma cell lines, HCC827 and H1975, contain subpopulations of cells that display an epithelial-to-mesenchymal phenotype and can thrive
Wenshu Chen et al.
Molecular carcinogenesis, 55(11), 1858-1866 (2015-11-27)
The interaction between epithelial and stromal cells through soluble factors such as cytokines plays an important role in carcinogenesis. Breaking this cancer-promoting interaction poses an opportunity for cancer prevention. The tumor-promoting function of interleukin 6 (IL-6) has been documented; however

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.