콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU086801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF10

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CGGGAACACCTGATTTTCATACAATCCCAGCATTTTGTTTGACTCCACCTTACAGTCCTTCTGACTTTGAACCCTCTCAAGTGTCAAATCTGATGGCACCAGCGCCATCTACTGTACACTTCAAGTCACTCTCAGATACTGCCAAACCTCACATTGCCGCACCTTTCAAAGAGGAAGAAAAGAGCCCAGTATCTGCCCCCAAACTCCCCAAAGCTCAGGCAACAAGTGTGATTCGTCATACAGCTGATGCCCAGCTATGTAACCACCAGACCTGCCCAATGAAAGCAGCCAGCATCCTCAACTATCAGAACAATTCTTTTAGAAGAAGAACCCACCTAAATGTTGAGGCTGCAAGAAAGAACATACCATGTGCCGCTGTGTCACCAAACAGATCCAAATGTGAGAGAAACACAGTGGCAGATGTTGATGAGA

Ensembl | 인체 수납 번호

ENSG00000155090

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KLF10(7071) , KLF10(7071)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Abigail A Delaney et al.
Biology of reproduction, 95(3), 62-62 (2016-08-05)
Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human
Vivek Kumar Mishra et al.
Cancer research, 77(9), 2387-2400 (2017-03-03)
TGFβ-SMAD signaling exerts a contextual effect that suppresses malignant growth early in epithelial tumorigenesis but promotes metastasis at later stages. Longstanding challenges in resolving this functional dichotomy may uncover new strategies to treat advanced carcinomas. The Krüppel-like transcription factor, KLF10
Malayannan Subramaniam et al.
Journal of cellular physiology, 233(4), 3540-3551 (2017-10-19)
TIEG knockout (KO) mice exhibit a female-specific osteopenic phenotype and altered expression of TIEG in humans is associated with osteoporosis. Gene expression profiling studies identified sclerostin as one of the most highly up-regulated transcripts in the long bones of TIEG
Jong Min Lee et al.
Molecular therapy. Nucleic acids, 17, 310-322 (2019-07-10)
We investigated the functional role of miR-892b as a novel inhibitor of chondrocyte hypertrophy during TGF-β-mediated chondrogenesis of human mesenchymal stem cells (hMSCs). The expression of miR-892b during TGF-β-mediated chondrogenesis of hMSCs and the effects of miR-892b overexpression on chondrogenic
Chun-Liang Lin et al.
EMBO molecular medicine, 11(5) (2019-04-06)
Diabetic nephropathy is the leading cause of end-stage renal disease. Although dysfunction of podocytes, also termed glomerular visceral epithelial cells, is critically associated with diabetic nephropathy, the mechanism underlying podocyte dysfunction still remains obscure. Here, we identify that KDM6A, a

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.