콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU086071

Sigma-Aldrich

MISSION® esiRNA

targeting human FAP

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTGGTCCCTGCAGTCAGAGTGTAAGGTCTGTATTTGCTGTTAATTGGATATCTTATCTTGCAAGTAAGGAAGGGATGGTCATTGCCTTGGTGGATGGTCGAGGAACAGCTTTCCAAGGTGACAAACTCCTCTATGCAGTGTATCGAAAGCTGGGTGTTTATGAAGTTGAAGACCAGATTACAGCTGTCAGAAAATTCATAGAAATGGGTTTCATTGATGAAAAAAGAATAGCCATATGGGGCTGGTCCTATGGAGGATACGTTTCATCACTGGCCCTTGCATCTGGAACTGGTCTTTTCAAATGTGGTATAGCAGTGGCTCCAGTCTCCAGCTGGGAATATTACGCGTCTGTCTACACAGAGAGATTCATGGGTCTCCCAACAAAGGATGATAATCTTGAGCACTATAAGAATTCAACTGTGATGGCAAGAGC

Ensembl | 인체 수납 번호

ENSG00000078098

NCBI 수납 번호

NM_004460

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FAP(2191) , FAP(2191)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yuli Lin et al.
Neoplasia (New York, N.Y.), 21(12), 1133-1142 (2019-11-24)
Desmoplasia is a hallmark of intrahepatic cholangiocarcinoma (ICC), which constitutes a barrier to infiltration of lymphocyte, but not myeloid cells. Given that dense desmoplastic stroma has been reported to be a barrier to infiltration of lymphocyte, but not myeloid cells.
Dimitrios Patsouras et al.
Molecular medicine reports, 11(6), 4585-4590 (2015-01-28)
Fibroblast activation protein (FAP), a selective protein for tumor stromal fibroblasts, is expressed in >90% of human epithelial carcinomas. A characteristic feature of pancreatic cancer is an extensive fibrotic or desmoplastic reaction surrounding the primary tumor. The present study aimed
Jochen Tillmanns et al.
Journal of molecular and cellular cardiology, 87, 194-203 (2015-09-01)
Fibroblast activation protein α (FAP) is a membrane-bound serine protease expressed by activated fibroblasts during wound healing in the skin. Expression of FAP after myocardial infarction (MI) and potential effects on cardiac wound healing are largely unknown. MI was induced

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.