콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU085201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGTCGAGGCTAGAGGCATTTGGAACAACAAATCTACGTAGTTAACTTGAAGAAACCGATTTTTAAAGTTGGTGCATCTAGAAAGCTTTGAATGCAGAAGCAAACAAGCTTGATTTTTCTAGCATCCTCTTAATGTGCAGCAAAAGCAGGCGACAAAATCTCCTGGCTTTACAGACAAAAATATTTCAGCAAACGTTGGGCATCATGGTTTTTGAAGGCTTTAGTTCTGCTTTCTGCCTCTCCTCCACAGCCCCAACCTCCCACCCCTGATACATGAGCCAGTGATTATTCTTGTTCAGGGAGAAGATCATTTAGATTTGTTTTGCATTCCTTAGAATGGAGGGCAACATTCCACAGCTGCCCTGGCTGTGATGAGTGTCCTTGCAGGGGCCGGAGTAGGAGCACTGGGGTGGGGGTGGAATTGGGGTTACTCGA

Ensembl | 인체 수납 번호

ENSG00000104419

NCBI 수납 번호

NM_006096

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NDRG1(10397) , NDRG1(10397)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Gang Cen et al.
Oncology reports, 37(2), 1189-1195 (2017-01-12)
The N-myc downstream regulated gene 1 (NDRG1) is differently expressed in human malignancies according to the tumor type. We investigated the expression of NDRG1 in pancreatic cancer tissues and cell lines as well as how it affects tumor growth, invasion and
Aiwei Li et al.
Scientific reports, 9(1), 5166-5166 (2019-03-28)
N-myc downstream regulated gene 1 (NDRG1) is an intracellular protein involved in cell differentiation and was recently reported to exert various effects in several cancers. However, its expression and role in bladder cancer remain unclear. Our study enrolled 100 bladder
Nan Meng et al.
Molecular reproduction and development, 86(9), 1210-1223 (2019-07-25)
Embryo implantation is an essential step for a successful pregnancy, and any defect in this process can lead to a range of pregnancy pathologies. The objective of this study was to explore the role of N-myc downregulated gene 1 (NDRG1)
Christopher J Sevinsky et al.
Breast cancer research : BCR, 20(1), 55-55 (2018-06-15)
Altered lipid metabolism is an emerging hallmark of aggressive breast cancers. The N-myc downstream regulated gene (NDRG1) gene plays a critical role in peripheral nervous system myelination, as inactivating mutations cause severe demyelinating neuropathy. In breast cancer, elevated NDRG1 expression
Zhi-Yan Hu et al.
Biochimica et biophysica acta, 1852(9), 1876-1886 (2015-06-15)
N-myc downstream-regulated gene 1 (NDRG1) has been implicated in tumorigenesis and metastasis in different cancers. However, its role in nasopharyngeal carcinoma remains unknown. We found that NDRG1 expression level was high in nasopharyngeal cancer 5-8F cells but low in 5-8F-LN
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.