콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU085021

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGTTCATCCAGTCGCTTTGTGCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAACCGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAACAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAAAGAAATGGTTGGTTGGTGGTTTTTTTTAGTTTGTATGCCAAGTGAGAAGATGGTATATTTGGTACTGTATTTCCCTCTCATTTTGACCTACTCTCATGCTGCAGAGGGTACTTTAAGACATACTCCTTCCATCAAATAGAACCACTATGAAGCTACCTCAAACTTCCAGTCAGGTAGTTGCAATTGAATTAAATTAGGAATAAATAAAAATGGATACTGGTGCAGTCATTATGAGAGGCA

Ensembl | 인체 수납 번호

ENSG00000164305

NCBI 수납 번호

NM_004346

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CASP3(836) , CASP3(836)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
RDV
CBV
WAV
RZU
XDU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Md Ataur Rahman et al.
Molecules and cells, 39(2), 119-128 (2015-12-18)
Angelica polymorpha Maxim root extract (APRE) is a popular herbal medicine used for treating stomachache, abdominal pain, stomach ulcers, and rheumatism; however the effect of APRE on cancer cells has not yet been explored. Here, we examined APRE cytotoxicity seen
Shan Shi et al.
Molecular medicine reports, 16(6), 9601-9606 (2017-10-19)
Mycoplasma pneumoniae (M. pneumoniae) infection is closely associated with pneumonia in children. Apoptosis of alveolar epithelial cells is involved in the development of pneumonia in children. The present study aimed to examine how caspase‑3 influences apoptosis rates in M. pneumoniae‑infected alveolar epithelial cells.
Chunxi Wang et al.
Cancers, 12(9) (2020-09-17)
T cell receptor (TCR) knockout is a critical step in producing universal chimeric antigen receptor T cells for cancer immunotherapy. A promising approach to achieving the knockout is to deliver the CRISPR/Cas9 system into cells using electrotransfer technology. However, clinical
Behrooz Soltani et al.
Cell biology and toxicology, 32(6), 543-561 (2016-07-31)
Protection against ionizing radiation (IR) and sensitization of cancer cells to IR are apparently contrasting phenomena. However, curcumin takes on these contrasting roles leading to either protection or enhanced apoptosis in different irradiated cells. Here we studied whether pretreatment with
Vijaya Lakshmi Bodiga et al.
Journal of inorganic biochemistry, 153, 49-59 (2015-10-06)
Heart tissue becomes zinc-depleted and the capacity to mobilize labile zinc is diminished, indicating zinc dyshomeostasis during ischemia/reperfusion (I/R). Apparently, zinc pyrithione restores the basal zinc levels during I/R and prevents apoptosis by activating phosphatidyl inositol-3-kinase/Akt and targeting mitochondrial permeability
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.